Incidental Mutation 'R6847:Ext1'
ID534829
Institutional Source Beutler Lab
Gene Symbol Ext1
Ensembl Gene ENSMUSG00000061731
Gene Nameexostoses (multiple) 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6847 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location53064038-53346159 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 53345154 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 70 (Q70H)
Ref Sequence ENSEMBL: ENSMUSP00000076505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077273] [ENSMUST00000133362]
Predicted Effect probably benign
Transcript: ENSMUST00000077273
AA Change: Q70H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000076505
Gene: ENSMUSG00000061731
AA Change: Q70H

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
low complexity region 29 41 N/A INTRINSIC
Pfam:Exostosin 110 396 6e-64 PFAM
Pfam:Glyco_transf_64 480 729 1.1e-106 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133362
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an endoplasmic reticulum-resident type II transmembrane glycosyltransferase involved in the chain elongation step of heparan sulfate biosynthesis. Mutations in this gene cause the type I form of multiple exostoses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display a lethal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik G A 9: 51,290,204 T184M probably damaging Het
Adam26a A G 8: 43,568,428 I675T probably benign Het
Adgrb3 A T 1: 25,093,922 M1121K probably benign Het
Ak9 A G 10: 41,357,801 probably null Het
Akr1c6 T A 13: 4,438,498 C34* probably null Het
Akt3 G A 1: 177,031,659 P449S probably damaging Het
Atg2b A T 12: 105,635,788 V1643E probably damaging Het
Atp2c1 T C 9: 105,418,579 I819V probably damaging Het
Casp3 C T 8: 46,636,266 A183V probably benign Het
Cdk1 A T 10: 69,338,528 D288E probably benign Het
Cep131 G A 11: 120,065,691 R944W probably damaging Het
Cep290 A G 10: 100,563,419 K2268E probably damaging Het
Crybg2 A G 4: 134,065,546 E164G probably benign Het
Cubn A C 2: 13,444,253 probably null Het
Dnajc14 A T 10: 128,816,787 E571D possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Eef1b2 A G 1: 63,178,489 E44G probably benign Het
Eml6 C T 11: 29,818,447 V747I probably benign Het
Gbp2b T A 3: 142,598,179 C12S probably damaging Het
Gbp8 A C 5: 105,031,227 D135E probably benign Het
Gm12886 A T 4: 121,416,719 L100* probably null Het
Gpatch1 A T 7: 35,293,558 probably null Het
Ifit3b A T 19: 34,611,525 M34L probably benign Het
Il12a G T 3: 68,695,566 D160Y probably damaging Het
Klhl2 A G 8: 64,759,782 L241P probably damaging Het
Krt80 T C 15: 101,358,729 E195G probably benign Het
Lgi1 T C 19: 38,301,290 V268A probably damaging Het
Lrrfip1 A T 1: 91,105,128 D216V probably damaging Het
Meis3 A G 7: 16,183,864 N314S probably damaging Het
Muc5ac C T 7: 141,809,744 probably benign Het
Myh15 A T 16: 49,145,088 I1119F possibly damaging Het
Nav2 A T 7: 49,491,456 Q916H probably benign Het
Ncam2 A T 16: 81,432,718 Q22L probably damaging Het
Olfr1474 A T 19: 13,471,038 I23F probably benign Het
P2rx4 G A 5: 122,727,751 V329M probably damaging Het
Peg10 A G 6: 4,754,279 probably benign Het
Pgp T C 17: 24,471,401 L267P probably damaging Het
Prdm2 A C 4: 143,132,950 S1257A probably benign Het
Prr12 T C 7: 45,045,740 N1434S unknown Het
Psmc3ip A T 11: 101,095,173 H40Q probably damaging Het
Ptprc A T 1: 138,088,545 N526K probably damaging Het
Sec63 T A 10: 42,791,253 D138E probably damaging Het
Serpinb13 A G 1: 106,998,933 N220D probably benign Het
Siva1 G A 12: 112,644,910 probably benign Het
Slc39a12 A G 2: 14,449,917 H546R probably damaging Het
Slc7a1 G A 5: 148,334,658 A497V probably benign Het
Smg5 G T 3: 88,342,552 K95N probably damaging Het
Speer1 G A 5: 11,344,167 V78M probably damaging Het
Traj50 T A 14: 54,167,644 probably benign Het
Ubr3 T C 2: 69,983,128 V1261A probably damaging Het
Zc3h11a A T 1: 133,638,962 probably null Het
Other mutations in Ext1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00710:Ext1 APN 15 53344873 missense probably damaging 1.00
IGL02081:Ext1 APN 15 53073446 nonsense probably null
IGL03147:Ext1 UTSW 15 53088072 missense probably damaging 0.98
R0047:Ext1 UTSW 15 53345146 missense probably benign
R0047:Ext1 UTSW 15 53345146 missense probably benign
R0437:Ext1 UTSW 15 53106106 missense probably damaging 1.00
R0881:Ext1 UTSW 15 53344483 missense probably benign 0.23
R1882:Ext1 UTSW 15 53075792 missense probably damaging 1.00
R2135:Ext1 UTSW 15 53101744 missense possibly damaging 0.88
R2175:Ext1 UTSW 15 53068728 missense probably damaging 1.00
R2762:Ext1 UTSW 15 53344927 missense probably benign 0.29
R3162:Ext1 UTSW 15 53344604 missense possibly damaging 0.82
R3162:Ext1 UTSW 15 53344604 missense possibly damaging 0.82
R3752:Ext1 UTSW 15 53075910 missense probably damaging 1.00
R3815:Ext1 UTSW 15 53345089 missense probably benign 0.05
R4096:Ext1 UTSW 15 53073357 missense probably damaging 1.00
R4298:Ext1 UTSW 15 53345125 missense probably benign 0.02
R4362:Ext1 UTSW 15 53107591 intron probably benign
R4550:Ext1 UTSW 15 53101786 missense probably damaging 0.99
R4647:Ext1 UTSW 15 53089987 missense possibly damaging 0.95
R4648:Ext1 UTSW 15 53089987 missense possibly damaging 0.95
R4871:Ext1 UTSW 15 53092377 missense probably benign 0.37
R4954:Ext1 UTSW 15 53344492 missense probably damaging 1.00
R5010:Ext1 UTSW 15 53092412 missense probably damaging 1.00
R5153:Ext1 UTSW 15 53075817 missense probably damaging 1.00
R5155:Ext1 UTSW 15 53075817 missense probably damaging 1.00
R5328:Ext1 UTSW 15 53075817 missense probably damaging 1.00
R5385:Ext1 UTSW 15 53075817 missense probably damaging 1.00
R5542:Ext1 UTSW 15 53075817 missense probably damaging 1.00
R5555:Ext1 UTSW 15 53088143 missense probably damaging 1.00
R5779:Ext1 UTSW 15 53344553 missense probably damaging 0.99
R5874:Ext1 UTSW 15 53101752 missense possibly damaging 0.61
R6401:Ext1 UTSW 15 53106097 missense possibly damaging 0.94
R6604:Ext1 UTSW 15 53083159 missense probably damaging 0.99
R6885:Ext1 UTSW 15 53101692 missense probably damaging 1.00
R7212:Ext1 UTSW 15 53345162 missense probably benign 0.00
R7315:Ext1 UTSW 15 53073387 missense probably damaging 1.00
R7361:Ext1 UTSW 15 53344723 missense probably damaging 1.00
R7474:Ext1 UTSW 15 53344489 missense probably damaging 0.98
R7853:Ext1 UTSW 15 53107485 missense probably damaging 0.96
R7860:Ext1 UTSW 15 53089939 missense possibly damaging 0.84
R7936:Ext1 UTSW 15 53107485 missense probably damaging 0.96
R7943:Ext1 UTSW 15 53089939 missense possibly damaging 0.84
R8013:Ext1 UTSW 15 53075887 missense possibly damaging 0.78
R8014:Ext1 UTSW 15 53075887 missense possibly damaging 0.78
X0021:Ext1 UTSW 15 53345273 missense probably benign
Predicted Primers PCR Primer
(F):5'- CGATGGCCGCTAGAATGTTTTG -3'
(R):5'- AAAACGCTATTTCATCCTGCTC -3'

Sequencing Primer
(F):5'- GCCGCTAGAATGTTTTGGTAAC -3'
(R):5'- GCTCTCAGCTGGCTCTTG -3'
Posted On2018-09-12