Mutagenetix > Incidental Mutation

Incidental Mutation 'R6847:Ncam2'

534832

Institutional Source

Beutler Lab

Gene Symbol

Ncam2

Ensembl Gene

ENSMUSG00000022762

Gene Name

neural cell adhesion molecule 2

Synonyms

Ocam, RNCAM, Ncam-2, R4B12 antigen

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6847 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

81200697-81626828 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 81432718 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 22 (Q22L)

Ref Sequence

ENSEMBL: ENSMUSP00000049390 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037785] [ENSMUST00000067602]

AlphaFold

O35136

Predicted Effect

probably damaging
Transcript: ENSMUST00000037785
AA Change: Q22L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000049390
Gene: ENSMUSG00000022762
AA Change: Q22L

Domain	Start	End	E-Value	Type
low complexity region	3	13	N/A	INTRINSIC
IGc2	33	100	3.18e-6	SMART
IGc2	127	193	1.13e-11	SMART
IGc2	223	288	2.03e-13	SMART
IGc2	313	387	1.12e-15	SMART
IGc2	413	482	9.93e-8	SMART
FN3	496	578	5.91e-13	SMART
FN3	594	675	2.87e-2	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000067602
AA Change: Q22L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000063468
Gene: ENSMUSG00000022762
AA Change: Q22L

Domain	Start	End	E-Value	Type
low complexity region	3	13	N/A	INTRINSIC
IGc2	33	100	3.18e-6	SMART
IGc2	127	193	1.13e-11	SMART
IGc2	223	288	2.03e-13	SMART
IGc2	313	387	1.12e-15	SMART
IGc2	413	482	9.93e-8	SMART
FN3	496	578	5.91e-13	SMART
FN3	594	675	2.87e-2	SMART
transmembrane domain	696	718	N/A	INTRINSIC
low complexity region	741	757	N/A	INTRINSIC
low complexity region	789	812	N/A	INTRINSIC

Meta Mutation Damage Score

0.4331

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.8%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the immunoglobulin superfamily. It is a type I membrane protein and may function in selective fasciculation and zone-to-zone projection of the primary olfactory axons. [provided by RefSeq, Jul 2008]
PHENOTYPE: A gene trap insertion into an intron of this gene results in no obvious phenotype. Mice homozygous for a knock-out allele exhibit exhibit increased proliferation rate and clonogenic frequency in spinal cord-derived neurospheres. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810046K07Rik	G	A	9: 51,290,204	T184M	probably damaging	Het
Adam26a	A	G	8: 43,568,428	I675T	probably benign	Het
Adgrb3	A	T	1: 25,093,922	M1121K	probably benign	Het
Ak9	A	G	10: 41,357,801		probably null	Het
Akr1c6	T	A	13: 4,438,498	C34*	probably null	Het
Akt3	G	A	1: 177,031,659	P449S	probably damaging	Het
Atg2b	A	T	12: 105,635,788	V1643E	probably damaging	Het
Atp2c1	T	C	9: 105,418,579	I819V	probably damaging	Het
Casp3	C	T	8: 46,636,266	A183V	probably benign	Het
Cdk1	A	T	10: 69,338,528	D288E	probably benign	Het
Cep131	G	A	11: 120,065,691	R944W	probably damaging	Het
Cep290	A	G	10: 100,563,419	K2268E	probably damaging	Het
Crybg2	A	G	4: 134,065,546	E164G	probably benign	Het
Cubn	A	C	2: 13,444,253		probably null	Het
Dnajc14	A	T	10: 128,816,787	E571D	possibly damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Eef1b2	A	G	1: 63,178,489	E44G	probably benign	Het
Eml6	C	T	11: 29,818,447	V747I	probably benign	Het
Ext1	T	G	15: 53,345,154	Q70H	probably benign	Het
Gbp2b	T	A	3: 142,598,179	C12S	probably damaging	Het
Gbp8	A	C	5: 105,031,227	D135E	probably benign	Het
Gm12886	A	T	4: 121,416,719	L100*	probably null	Het
Gpatch1	A	T	7: 35,293,558		probably null	Het
Ifit3b	A	T	19: 34,611,525	M34L	probably benign	Het
Il12a	G	T	3: 68,695,566	D160Y	probably damaging	Het
Klhl2	A	G	8: 64,759,782	L241P	probably damaging	Het
Krt80	T	C	15: 101,358,729	E195G	probably benign	Het
Lgi1	T	C	19: 38,301,290	V268A	probably damaging	Het
Lrrfip1	A	T	1: 91,105,128	D216V	probably damaging	Het
Meis3	A	G	7: 16,183,864	N314S	probably damaging	Het
Muc5ac	C	T	7: 141,809,744		probably benign	Het
Myh15	A	T	16: 49,145,088	I1119F	possibly damaging	Het
Nav2	A	T	7: 49,491,456	Q916H	probably benign	Het
Olfr1474	A	T	19: 13,471,038	I23F	probably benign	Het
P2rx4	G	A	5: 122,727,751	V329M	probably damaging	Het
Peg10	A	G	6: 4,754,279		probably benign	Het
Pgp	T	C	17: 24,471,401	L267P	probably damaging	Het
Prdm2	A	C	4: 143,132,950	S1257A	probably benign	Het
Prr12	T	C	7: 45,045,740	N1434S	unknown	Het
Psmc3ip	A	T	11: 101,095,173	H40Q	probably damaging	Het
Ptprc	A	T	1: 138,088,545	N526K	probably damaging	Het
Sec63	T	A	10: 42,791,253	D138E	probably damaging	Het
Serpinb13	A	G	1: 106,998,933	N220D	probably benign	Het
Siva1	G	A	12: 112,644,910		probably benign	Het
Slc39a12	A	G	2: 14,449,917	H546R	probably damaging	Het
Slc7a1	G	A	5: 148,334,658	A497V	probably benign	Het
Smg5	G	T	3: 88,342,552	K95N	probably damaging	Het
Speer1	G	A	5: 11,344,167	V78M	probably damaging	Het
Traj50	T	A	14: 54,167,644		probably benign	Het
Ubr3	T	C	2: 69,983,128	V1261A	probably damaging	Het
Zc3h11a	A	T	1: 133,638,962		probably null	Het

Other mutations in Ncam2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01138:Ncam2	APN	16	81517579	missense	probably damaging	1.00
IGL01369:Ncam2	APN	16	81461571	missense	probably benign	0.09
IGL01554:Ncam2	APN	16	81512935	missense	possibly damaging	0.88
IGL01892:Ncam2	APN	16	81589699	missense	possibly damaging	0.71
IGL02320:Ncam2	APN	16	81434837	missense	probably damaging	0.99
IGL02669:Ncam2	APN	16	81517541	missense	probably benign	0.18
IGL03073:Ncam2	APN	16	81621347	missense	possibly damaging	0.70
IGL03353:Ncam2	APN	16	81434900	missense	probably benign	0.04
BB009:Ncam2	UTSW	16	81615820	missense	probably damaging	0.99
BB019:Ncam2	UTSW	16	81615820	missense	probably damaging	0.99
R0087:Ncam2	UTSW	16	81434901	missense	probably benign	0.11
R0097:Ncam2	UTSW	16	81517537	missense	probably damaging	1.00
R0276:Ncam2	UTSW	16	81517629	splice site	probably benign
R0279:Ncam2	UTSW	16	81623337	splice site	probably benign
R0471:Ncam2	UTSW	16	81200884	start gained	probably benign
R0523:Ncam2	UTSW	16	81461643	missense	probably damaging	0.99
R1353:Ncam2	UTSW	16	81200915	start codon destroyed	probably null
R1646:Ncam2	UTSW	16	81465706	critical splice donor site	probably benign
R1884:Ncam2	UTSW	16	81437683	missense	probably damaging	1.00
R2002:Ncam2	UTSW	16	81589698	missense	possibly damaging	0.70
R2157:Ncam2	UTSW	16	81490389	missense	probably damaging	1.00
R2330:Ncam2	UTSW	16	81512921	missense	probably benign	0.17
R2404:Ncam2	UTSW	16	81490240	splice site	probably benign
R2434:Ncam2	UTSW	16	81595225	missense	probably benign	0.01
R3104:Ncam2	UTSW	16	81465710	splice site	probably benign
R3842:Ncam2	UTSW	16	81434810	missense	probably damaging	1.00
R3954:Ncam2	UTSW	16	81589724	missense	probably damaging	1.00
R4039:Ncam2	UTSW	16	81490323	missense	probably benign	0.02
R4210:Ncam2	UTSW	16	81527103	missense	probably benign	0.02
R4514:Ncam2	UTSW	16	81512996	missense	probably benign	0.13
R4583:Ncam2	UTSW	16	81517557	missense	probably damaging	1.00
R4586:Ncam2	UTSW	16	81465569	missense	probably benign	0.06
R4710:Ncam2	UTSW	16	81465706	critical splice donor site	probably null
R4732:Ncam2	UTSW	16	81434884	missense	possibly damaging	0.63
R4733:Ncam2	UTSW	16	81434884	missense	possibly damaging	0.63
R4876:Ncam2	UTSW	16	81490346	missense	probably benign	0.27
R4923:Ncam2	UTSW	16	81589791	missense	possibly damaging	0.48
R5131:Ncam2	UTSW	16	81437662	missense	probably benign	0.44
R5329:Ncam2	UTSW	16	81434819	missense	probably damaging	1.00
R5478:Ncam2	UTSW	16	81434878	nonsense	probably null
R5479:Ncam2	UTSW	16	81434878	nonsense	probably null
R5481:Ncam2	UTSW	16	81434878	nonsense	probably null
R5519:Ncam2	UTSW	16	81434878	nonsense	probably null
R5522:Ncam2	UTSW	16	81434878	nonsense	probably null
R5523:Ncam2	UTSW	16	81434878	nonsense	probably null
R5524:Ncam2	UTSW	16	81434878	nonsense	probably null
R5526:Ncam2	UTSW	16	81434878	nonsense	probably null
R5718:Ncam2	UTSW	16	81589814	splice site	probably null
R5793:Ncam2	UTSW	16	81576103	missense	possibly damaging	0.95
R6050:Ncam2	UTSW	16	81443166	nonsense	probably null
R6212:Ncam2	UTSW	16	81432762	missense	probably damaging	1.00
R6935:Ncam2	UTSW	16	81526991	missense	probably benign	0.24
R7159:Ncam2	UTSW	16	81490374	missense	probably damaging	1.00
R7193:Ncam2	UTSW	16	81589795	missense	probably damaging	1.00
R7232:Ncam2	UTSW	16	81512871	missense	probably damaging	1.00
R7346:Ncam2	UTSW	16	81623368	missense	probably damaging	1.00
R7568:Ncam2	UTSW	16	81589801	missense	probably benign	0.19
R7686:Ncam2	UTSW	16	81621454	missense	probably damaging	0.99
R7759:Ncam2	UTSW	16	81615784	missense	probably damaging	1.00
R7848:Ncam2	UTSW	16	81490379	missense	probably benign
R7932:Ncam2	UTSW	16	81615820	missense	probably damaging	0.99
R8078:Ncam2	UTSW	16	81443248	missense	possibly damaging	0.60
R8287:Ncam2	UTSW	16	81526995	missense	probably benign	0.07
R8354:Ncam2	UTSW	16	81512959	missense	probably benign	0.00
R8429:Ncam2	UTSW	16	81589635	missense	probably damaging	1.00
R8507:Ncam2	UTSW	16	81512979	missense	possibly damaging	0.63
R8546:Ncam2	UTSW	16	81517531	missense	probably benign	0.21
R8775:Ncam2	UTSW	16	81517541	missense	probably benign	0.18
R8775-TAIL:Ncam2	UTSW	16	81517541	missense	probably benign	0.18
R9082:Ncam2	UTSW	16	81615772	missense	probably damaging	1.00
R9346:Ncam2	UTSW	16	81455316	missense	probably benign	0.07
R9386:Ncam2	UTSW	16	81455364	missense	probably damaging	1.00
R9498:Ncam2	UTSW	16	81512999	missense	probably benign	0.03
R9510:Ncam2	UTSW	16	81623453	makesense	probably null
R9587:Ncam2	UTSW	16	81465613	missense	probably benign	0.00
R9616:Ncam2	UTSW	16	81443254	missense	probably damaging	1.00
R9642:Ncam2	UTSW	16	81621363	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GGTAGTAAATGCACACAACTCTAGTG -3'
(R):5'- GGGTTCAAATTAATCCTAGTATGGC -3'

Sequencing Primer
(F):5'- GCACACAACTCTAGTGTATAACATTG -3'
(R):5'- TAACCATCATCAACATTTTCCAGTC -3'

Posted On

2018-09-12