Incidental Mutation 'R6847:Olfr1474'
ID 534834
Institutional Source Beutler Lab
Gene Symbol Olfr1474
Ensembl Gene ENSMUSG00000096273
Gene Name olfactory receptor 1474
Synonyms MOR202-42, MOR202-26P, GA_x6K02T2RE5P-3803583-3804527
MMRRC Submission
Accession Numbers

Genbank: NM_001011842.1
Essential gene? Probably non essential (E-score: 0.074) question?
Stock # R6847 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 13469565-13472157 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 13471038 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 23 (I23F)
Ref Sequence ENSEMBL: ENSMUSP00000151810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096202] [ENSMUST00000207529] [ENSMUST00000220113]
AlphaFold Q7TQQ8
Predicted Effect probably benign
Transcript: ENSMUST00000096202
AA Change: I23F

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000093916
Gene: ENSMUSG00000096273
AA Change: I23F

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.6e-52 PFAM
Pfam:7TM_GPCR_Srsx 33 303 1e-7 PFAM
Pfam:7tm_1 39 288 8.7e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207529
Predicted Effect probably benign
Transcript: ENSMUST00000220113
AA Change: I23F

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI

none
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik G A 9: 51,290,204 T184M probably damaging Het
Adam26a A G 8: 43,568,428 I675T probably benign Het
Adgrb3 A T 1: 25,093,922 M1121K probably benign Het
Ak9 A G 10: 41,357,801 probably null Het
Akr1c6 T A 13: 4,438,498 C34* probably null Het
Akt3 G A 1: 177,031,659 P449S probably damaging Het
Atg2b A T 12: 105,635,788 V1643E probably damaging Het
Atp2c1 T C 9: 105,418,579 I819V probably damaging Het
Casp3 C T 8: 46,636,266 A183V probably benign Het
Cdk1 A T 10: 69,338,528 D288E probably benign Het
Cep131 G A 11: 120,065,691 R944W probably damaging Het
Cep290 A G 10: 100,563,419 K2268E probably damaging Het
Crybg2 A G 4: 134,065,546 E164G probably benign Het
Cubn A C 2: 13,444,253 probably null Het
Dnajc14 A T 10: 128,816,787 E571D possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Eef1b2 A G 1: 63,178,489 E44G probably benign Het
Eml6 C T 11: 29,818,447 V747I probably benign Het
Ext1 T G 15: 53,345,154 Q70H probably benign Het
Gbp2b T A 3: 142,598,179 C12S probably damaging Het
Gbp8 A C 5: 105,031,227 D135E probably benign Het
Gm12886 A T 4: 121,416,719 L100* probably null Het
Gpatch1 A T 7: 35,293,558 probably null Het
Ifit3b A T 19: 34,611,525 M34L probably benign Het
Il12a G T 3: 68,695,566 D160Y probably damaging Het
Klhl2 A G 8: 64,759,782 L241P probably damaging Het
Krt80 T C 15: 101,358,729 E195G probably benign Het
Lgi1 T C 19: 38,301,290 V268A probably damaging Het
Lrrfip1 A T 1: 91,105,128 D216V probably damaging Het
Meis3 A G 7: 16,183,864 N314S probably damaging Het
Muc5ac C T 7: 141,809,744 probably benign Het
Myh15 A T 16: 49,145,088 I1119F possibly damaging Het
Nav2 A T 7: 49,491,456 Q916H probably benign Het
Ncam2 A T 16: 81,432,718 Q22L probably damaging Het
P2rx4 G A 5: 122,727,751 V329M probably damaging Het
Peg10 A G 6: 4,754,279 probably benign Het
Pgp T C 17: 24,471,401 L267P probably damaging Het
Prdm2 A C 4: 143,132,950 S1257A probably benign Het
Prr12 T C 7: 45,045,740 N1434S unknown Het
Psmc3ip A T 11: 101,095,173 H40Q probably damaging Het
Ptprc A T 1: 138,088,545 N526K probably damaging Het
Sec63 T A 10: 42,791,253 D138E probably damaging Het
Serpinb13 A G 1: 106,998,933 N220D probably benign Het
Siva1 G A 12: 112,644,910 probably benign Het
Slc39a12 A G 2: 14,449,917 H546R probably damaging Het
Slc7a1 G A 5: 148,334,658 A497V probably benign Het
Smg5 G T 3: 88,342,552 K95N probably damaging Het
Speer1 G A 5: 11,344,167 V78M probably damaging Het
Traj50 T A 14: 54,167,644 probably benign Het
Ubr3 T C 2: 69,983,128 V1261A probably damaging Het
Zc3h11a A T 1: 133,638,962 probably null Het
Other mutations in Olfr1474
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03256:Olfr1474 APN 19 13471267 missense probably damaging 0.99
D605:Olfr1474 UTSW 19 13471157 nonsense probably null
R0173:Olfr1474 UTSW 19 13471701 missense probably benign 0.02
R1102:Olfr1474 UTSW 19 13471407 missense probably damaging 0.97
R1515:Olfr1474 UTSW 19 13471680 missense probably damaging 0.97
R1780:Olfr1474 UTSW 19 13471362 missense probably benign 0.14
R2061:Olfr1474 UTSW 19 13471241 missense probably damaging 0.98
R4016:Olfr1474 UTSW 19 13471197 missense possibly damaging 0.95
R4485:Olfr1474 UTSW 19 13471555 missense probably benign 0.08
R5119:Olfr1474 UTSW 19 13471546 missense probably benign 0.00
R5150:Olfr1474 UTSW 19 13471430 missense probably benign 0.01
R5156:Olfr1474 UTSW 19 13471673 missense probably damaging 1.00
R5699:Olfr1474 UTSW 19 13470972 start codon destroyed probably null 0.78
R5800:Olfr1474 UTSW 19 13471896 missense probably benign 0.06
R5840:Olfr1474 UTSW 19 13471878 missense probably benign 0.01
R5953:Olfr1474 UTSW 19 13471368 missense possibly damaging 0.92
R5997:Olfr1474 UTSW 19 13471506 missense probably benign 0.12
R6233:Olfr1474 UTSW 19 13471740 missense probably damaging 1.00
R6488:Olfr1474 UTSW 19 13471617 missense probably damaging 1.00
R6964:Olfr1474 UTSW 19 13471361 nonsense probably null
R7214:Olfr1474 UTSW 19 13470973 start codon destroyed probably null 1.00
R8001:Olfr1474 UTSW 19 13471422 missense probably benign 0.03
R8035:Olfr1474 UTSW 19 13471899 missense probably benign
R8129:Olfr1474 UTSW 19 13471144 missense probably damaging 1.00
R9018:Olfr1474 UTSW 19 13471357 missense possibly damaging 0.60
R9061:Olfr1474 UTSW 19 13471159 missense probably damaging 0.98
R9065:Olfr1474 UTSW 19 13471306 missense probably damaging 0.97
R9373:Olfr1474 UTSW 19 13471852 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACCCCTGGTATCATATATTCTG -3'
(R):5'- AACCCTTCTATCACCTTGGGG -3'

Sequencing Primer
(F):5'- ACATGTGTATCACTTCCTTATGAGC -3'
(R):5'- CCTTGGGGGTGATTGCTGAG -3'
Posted On 2018-09-12