Incidental Mutation 'R6847:Or5b118'
ID 534834
Institutional Source Beutler Lab
Gene Symbol Or5b118
Ensembl Gene ENSMUSG00000096273
Gene Name olfactory receptor family 5 subfamily B member 118
Synonyms Olfr1474, MOR202-26P, GA_x6K02T2RE5P-3803583-3804527, MOR202-42
MMRRC Submission 045021-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.070) question?
Stock # R6847 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 13448336-13449280 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 13448402 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 23 (I23F)
Ref Sequence ENSEMBL: ENSMUSP00000151810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096202] [ENSMUST00000207529] [ENSMUST00000220113]
AlphaFold Q7TQQ8
Predicted Effect probably benign
Transcript: ENSMUST00000096202
AA Change: I23F

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000093916
Gene: ENSMUSG00000096273
AA Change: I23F

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.6e-52 PFAM
Pfam:7TM_GPCR_Srsx 33 303 1e-7 PFAM
Pfam:7tm_1 39 288 8.7e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207529
Predicted Effect probably benign
Transcript: ENSMUST00000220113
AA Change: I23F

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI

none

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a A G 8: 44,021,465 (GRCm39) I675T probably benign Het
Adgrb3 A T 1: 25,133,003 (GRCm39) M1121K probably benign Het
Ak9 A G 10: 41,233,797 (GRCm39) probably null Het
Akr1c6 T A 13: 4,488,497 (GRCm39) C34* probably null Het
Akt3 G A 1: 176,859,225 (GRCm39) P449S probably damaging Het
Atg2b A T 12: 105,602,047 (GRCm39) V1643E probably damaging Het
Atp2c1 T C 9: 105,295,778 (GRCm39) I819V probably damaging Het
Casp3 C T 8: 47,089,301 (GRCm39) A183V probably benign Het
Cdk1 A T 10: 69,174,358 (GRCm39) D288E probably benign Het
Cep131 G A 11: 119,956,517 (GRCm39) R944W probably damaging Het
Cep290 A G 10: 100,399,281 (GRCm39) K2268E probably damaging Het
Crybg2 A G 4: 133,792,857 (GRCm39) E164G probably benign Het
Cubn A C 2: 13,449,064 (GRCm39) probably null Het
Dnajc14 A T 10: 128,652,656 (GRCm39) E571D possibly damaging Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Het
Eef1b2 A G 1: 63,217,648 (GRCm39) E44G probably benign Het
Eml6 C T 11: 29,768,447 (GRCm39) V747I probably benign Het
Ext1 T G 15: 53,208,550 (GRCm39) Q70H probably benign Het
Gbp2b T A 3: 142,303,940 (GRCm39) C12S probably damaging Het
Gbp8 A C 5: 105,179,093 (GRCm39) D135E probably benign Het
Gm12886 A T 4: 121,273,916 (GRCm39) L100* probably null Het
Gpatch1 A T 7: 34,992,983 (GRCm39) probably null Het
Ifit3b A T 19: 34,588,925 (GRCm39) M34L probably benign Het
Il12a G T 3: 68,602,899 (GRCm39) D160Y probably damaging Het
Klhl2 A G 8: 65,212,816 (GRCm39) L241P probably damaging Het
Krt80 T C 15: 101,256,610 (GRCm39) E195G probably benign Het
Lgi1 T C 19: 38,289,738 (GRCm39) V268A probably damaging Het
Lrrfip1 A T 1: 91,032,850 (GRCm39) D216V probably damaging Het
Meis3 A G 7: 15,917,789 (GRCm39) N314S probably damaging Het
Muc5ac C T 7: 141,363,481 (GRCm39) probably benign Het
Myh15 A T 16: 48,965,451 (GRCm39) I1119F possibly damaging Het
Nav2 A T 7: 49,141,204 (GRCm39) Q916H probably benign Het
Ncam2 A T 16: 81,229,606 (GRCm39) Q22L probably damaging Het
P2rx4 G A 5: 122,865,814 (GRCm39) V329M probably damaging Het
Peg10 A G 6: 4,754,279 (GRCm39) probably benign Het
Pgp T C 17: 24,690,375 (GRCm39) L267P probably damaging Het
Pou2af2 G A 9: 51,201,504 (GRCm39) T184M probably damaging Het
Prdm2 A C 4: 142,859,520 (GRCm39) S1257A probably benign Het
Prr12 T C 7: 44,695,164 (GRCm39) N1434S unknown Het
Psmc3ip A T 11: 100,985,999 (GRCm39) H40Q probably damaging Het
Ptprc A T 1: 138,016,283 (GRCm39) N526K probably damaging Het
Sec63 T A 10: 42,667,249 (GRCm39) D138E probably damaging Het
Serpinb13 A G 1: 106,926,663 (GRCm39) N220D probably benign Het
Siva1 G A 12: 112,611,344 (GRCm39) probably benign Het
Slc39a12 A G 2: 14,454,728 (GRCm39) H546R probably damaging Het
Slc7a1 G A 5: 148,271,468 (GRCm39) A497V probably benign Het
Smg5 G T 3: 88,249,859 (GRCm39) K95N probably damaging Het
Speer1a G A 5: 11,394,134 (GRCm39) V78M probably damaging Het
Traj50 T A 14: 54,405,101 (GRCm39) probably benign Het
Ubr3 T C 2: 69,813,472 (GRCm39) V1261A probably damaging Het
Zc3h11a A T 1: 133,566,700 (GRCm39) probably null Het
Other mutations in Or5b118
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03256:Or5b118 APN 19 13,448,631 (GRCm39) missense probably damaging 0.99
D605:Or5b118 UTSW 19 13,448,521 (GRCm39) nonsense probably null
R0173:Or5b118 UTSW 19 13,449,065 (GRCm39) missense probably benign 0.02
R1102:Or5b118 UTSW 19 13,448,771 (GRCm39) missense probably damaging 0.97
R1515:Or5b118 UTSW 19 13,449,044 (GRCm39) missense probably damaging 0.97
R1780:Or5b118 UTSW 19 13,448,726 (GRCm39) missense probably benign 0.14
R2061:Or5b118 UTSW 19 13,448,605 (GRCm39) missense probably damaging 0.98
R4016:Or5b118 UTSW 19 13,448,561 (GRCm39) missense possibly damaging 0.95
R4485:Or5b118 UTSW 19 13,448,919 (GRCm39) missense probably benign 0.08
R5119:Or5b118 UTSW 19 13,448,910 (GRCm39) missense probably benign 0.00
R5150:Or5b118 UTSW 19 13,448,794 (GRCm39) missense probably benign 0.01
R5156:Or5b118 UTSW 19 13,449,037 (GRCm39) missense probably damaging 1.00
R5699:Or5b118 UTSW 19 13,448,336 (GRCm39) start codon destroyed probably null 0.78
R5800:Or5b118 UTSW 19 13,449,260 (GRCm39) missense probably benign 0.06
R5840:Or5b118 UTSW 19 13,449,242 (GRCm39) missense probably benign 0.01
R5953:Or5b118 UTSW 19 13,448,732 (GRCm39) missense possibly damaging 0.92
R5997:Or5b118 UTSW 19 13,448,870 (GRCm39) missense probably benign 0.12
R6233:Or5b118 UTSW 19 13,449,104 (GRCm39) missense probably damaging 1.00
R6488:Or5b118 UTSW 19 13,448,981 (GRCm39) missense probably damaging 1.00
R6964:Or5b118 UTSW 19 13,448,725 (GRCm39) nonsense probably null
R7214:Or5b118 UTSW 19 13,448,337 (GRCm39) start codon destroyed probably null 1.00
R8001:Or5b118 UTSW 19 13,448,786 (GRCm39) missense probably benign 0.03
R8035:Or5b118 UTSW 19 13,449,263 (GRCm39) missense probably benign
R8129:Or5b118 UTSW 19 13,448,508 (GRCm39) missense probably damaging 1.00
R9018:Or5b118 UTSW 19 13,448,721 (GRCm39) missense possibly damaging 0.60
R9061:Or5b118 UTSW 19 13,448,523 (GRCm39) missense probably damaging 0.98
R9065:Or5b118 UTSW 19 13,448,670 (GRCm39) missense probably damaging 0.97
R9373:Or5b118 UTSW 19 13,449,216 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACCCCTGGTATCATATATTCTG -3'
(R):5'- AACCCTTCTATCACCTTGGGG -3'

Sequencing Primer
(F):5'- ACATGTGTATCACTTCCTTATGAGC -3'
(R):5'- CCTTGGGGGTGATTGCTGAG -3'
Posted On 2018-09-12