Incidental Mutation 'R6848:Igsf9'
ID534841
Institutional Source Beutler Lab
Gene Symbol Igsf9
Ensembl Gene ENSMUSG00000037995
Gene Nameimmunoglobulin superfamily, member 9
SynonymsNRT1, Dasm1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6848 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location172481788-172498878 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 172495762 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 681 (L681P)
Ref Sequence ENSEMBL: ENSMUSP00000106866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052629] [ENSMUST00000111230] [ENSMUST00000111235] [ENSMUST00000127482] [ENSMUST00000135267] [ENSMUST00000192460]
Predicted Effect probably damaging
Transcript: ENSMUST00000052629
AA Change: L681P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000058275
Gene: ENSMUSG00000037995
AA Change: L681P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 26 131 6.81e-6 SMART
IGc2 149 213 4.92e-12 SMART
IG 233 320 8.64e-8 SMART
IG_like 329 412 4.3e1 SMART
IGc2 431 493 9.12e-7 SMART
FN3 508 593 1.82e-4 SMART
FN3 624 705 7.01e-6 SMART
transmembrane domain 737 759 N/A INTRINSIC
low complexity region 785 800 N/A INTRINSIC
low complexity region 823 834 N/A INTRINSIC
low complexity region 909 930 N/A INTRINSIC
low complexity region 942 953 N/A INTRINSIC
low complexity region 1143 1165 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111230
SMART Domains Protein: ENSMUSP00000106861
Gene: ENSMUSG00000026547

DomainStartEndE-ValueType
CH 26 132 2.84e-24 SMART
Pfam:Calponin 174 199 1.6e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111235
AA Change: L681P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106866
Gene: ENSMUSG00000037995
AA Change: L681P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 26 131 6.81e-6 SMART
IGc2 149 213 4.92e-12 SMART
IG 233 320 8.64e-8 SMART
IG_like 329 412 4.3e1 SMART
IGc2 431 493 9.12e-7 SMART
FN3 508 593 1.82e-4 SMART
FN3 624 705 7.01e-6 SMART
transmembrane domain 737 759 N/A INTRINSIC
low complexity region 785 800 N/A INTRINSIC
low complexity region 823 834 N/A INTRINSIC
low complexity region 909 930 N/A INTRINSIC
low complexity region 942 953 N/A INTRINSIC
low complexity region 1143 1165 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127482
SMART Domains Protein: ENSMUSP00000117854
Gene: ENSMUSG00000037995

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 26 131 6.81e-6 SMART
IGc2 149 213 4.92e-12 SMART
IG 233 320 8.64e-8 SMART
IG_like 329 412 4.3e1 SMART
IGc2 431 493 9.12e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135267
SMART Domains Protein: ENSMUSP00000116948
Gene: ENSMUSG00000037995

DomainStartEndE-ValueType
IG_like 4 68 3.29e1 SMART
IGc2 86 148 3.03e-12 SMART
low complexity region 156 168 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192460
SMART Domains Protein: ENSMUSP00000141983
Gene: ENSMUSG00000026547

DomainStartEndE-ValueType
Pfam:CH 27 90 9.2e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193620
Meta Mutation Damage Score 0.7277 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 98% (54/55)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted null mutation are viable and fertile but show abnormal miniature inhibitory postsynaptic currents and increased susceptibility to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap1 T C 11: 69,884,661 N290S probably damaging Het
Acox3 G T 5: 35,592,184 G218C probably damaging Het
Acsf3 G A 8: 122,790,590 G375D probably damaging Het
Adamts9 G T 6: 92,863,354 N568K possibly damaging Het
Akr1cl G A 1: 65,024,769 T87I probably damaging Het
Cacna1s G A 1: 136,092,694 R823Q probably benign Het
Casp16-ps A T 17: 23,551,079 C175* probably null Het
Cast T C 13: 74,695,933 K694R possibly damaging Het
Cep70 G A 9: 99,262,901 R100H probably benign Het
Cep72 C T 13: 74,038,276 A259T possibly damaging Het
Chsy1 T A 7: 66,171,037 M340K probably damaging Het
Col27a1 T C 4: 63,302,371 S182P probably benign Het
Crlf2 A C 5: 109,557,031 F103V possibly damaging Het
Dync2h1 T C 9: 7,159,632 N652S probably benign Het
Ephx4 G A 5: 107,426,918 G274D probably damaging Het
Fer T A 17: 63,991,606 F517I probably damaging Het
Fsip2 A T 2: 82,982,787 H3150L probably benign Het
Gata3 T A 2: 9,858,528 N392Y possibly damaging Het
Gm17660 A G 5: 104,074,737 probably benign Het
Gm5136 A T 10: 108,699,590 V168E probably damaging Het
Gria4 C T 9: 4,793,822 V79M probably damaging Het
Grk3 A C 5: 112,985,775 N60K probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Igf1r T G 7: 68,004,179 I155R probably damaging Het
Intu T C 3: 40,694,255 M789T probably benign Het
Kit A T 5: 75,607,212 Q85L probably benign Het
Klhdc2 T A 12: 69,308,976 C325* probably null Het
Mcidas A G 13: 112,993,885 E5G probably benign Het
Mcm5 G T 8: 75,127,290 R724L possibly damaging Het
Nrbp2 G A 15: 76,091,483 probably benign Het
Nrg1 A G 8: 31,818,056 I655T probably damaging Het
Nsun4 T C 4: 116,052,934 D143G possibly damaging Het
Olfr214 T C 6: 116,556,775 S117P probably damaging Het
Olfr610 A G 7: 103,506,457 V163A possibly damaging Het
Olfr74 A T 2: 87,974,170 V165E possibly damaging Het
Opn3 C T 1: 175,663,049 V349M probably damaging Het
Pank2 C A 2: 131,282,626 L297I probably damaging Het
Pcdh20 T A 14: 88,467,254 E870V probably benign Het
Pdcd6 T A 13: 74,309,840 M71L possibly damaging Het
Phkb A T 8: 86,029,617 I847F probably damaging Het
Psmb1 A G 17: 15,477,247 F202S probably benign Het
Pwp2 C G 10: 78,184,293 probably null Het
Rbms3 A G 9: 117,251,741 Y21H probably damaging Het
Rhbdl1 T A 17: 25,836,184 K17* probably null Het
Rp1l1 C A 14: 64,028,218 Q418K possibly damaging Het
Slc22a4 A T 11: 54,007,789 V159E possibly damaging Het
Spata31d1a T C 13: 59,701,963 T784A possibly damaging Het
Tll1 A G 8: 64,098,510 M279T probably damaging Het
Tmem163 A T 1: 127,551,380 V134D probably damaging Het
Top2b A G 14: 16,409,958 N875S possibly damaging Het
Tpd52l1 T C 10: 31,332,857 E205G probably benign Het
Tpsb2 T A 17: 25,367,828 Y271* probably null Het
Ugt3a1 G A 15: 9,280,052 probably null Het
Vmn2r67 T C 7: 85,152,632 M154V probably benign Het
Zfp740 T G 15: 102,208,808 I89S probably benign Het
Other mutations in Igsf9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Igsf9 APN 1 172496636 missense probably benign
IGL01665:Igsf9 APN 1 172492171 nonsense probably null
IGL01808:Igsf9 APN 1 172484803 missense probably benign 0.03
IGL02480:Igsf9 APN 1 172496913 missense possibly damaging 0.88
IGL02480:Igsf9 APN 1 172484778 intron probably benign
IGL03087:Igsf9 APN 1 172490743 missense probably benign 0.00
R1258:Igsf9 UTSW 1 172492155 missense probably benign 0.02
R1419:Igsf9 UTSW 1 172498011 missense probably damaging 1.00
R2246:Igsf9 UTSW 1 172491649 missense probably benign 0.21
R2427:Igsf9 UTSW 1 172490739 missense probably damaging 0.98
R3900:Igsf9 UTSW 1 172489558 missense probably damaging 1.00
R4334:Igsf9 UTSW 1 172494212 nonsense probably null
R4831:Igsf9 UTSW 1 172491888 missense probably damaging 1.00
R4844:Igsf9 UTSW 1 172497170 missense probably benign 0.00
R4894:Igsf9 UTSW 1 172498067 missense probably benign 0.00
R5016:Igsf9 UTSW 1 172490712 missense probably damaging 1.00
R5358:Igsf9 UTSW 1 172484511 missense probably benign 0.01
R5705:Igsf9 UTSW 1 172494771 missense possibly damaging 0.80
R5762:Igsf9 UTSW 1 172498438 missense probably damaging 1.00
R6058:Igsf9 UTSW 1 172484889 missense probably damaging 1.00
R6510:Igsf9 UTSW 1 172490297 missense possibly damaging 0.78
R6821:Igsf9 UTSW 1 172484493 missense probably benign 0.39
R6822:Igsf9 UTSW 1 172497163 missense possibly damaging 0.95
R6829:Igsf9 UTSW 1 172495674 missense probably benign
R6874:Igsf9 UTSW 1 172494529 missense probably benign
R7224:Igsf9 UTSW 1 172494782 missense probably damaging 1.00
R7284:Igsf9 UTSW 1 172496912 missense probably damaging 0.99
R7292:Igsf9 UTSW 1 172491757 critical splice donor site probably null
R7409:Igsf9 UTSW 1 172495274 missense probably benign
R7744:Igsf9 UTSW 1 172492185 missense probably benign 0.37
R7826:Igsf9 UTSW 1 172491630 missense probably benign 0.01
R7893:Igsf9 UTSW 1 172497302 missense probably damaging 1.00
R7976:Igsf9 UTSW 1 172497302 missense probably damaging 1.00
V7732:Igsf9 UTSW 1 172490393 missense probably benign 0.19
Z1176:Igsf9 UTSW 1 172492149 missense probably damaging 0.99
Z1176:Igsf9 UTSW 1 172495226 missense probably benign 0.27
Z1177:Igsf9 UTSW 1 172494872 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAGGGCTTCCTACCACACC -3'
(R):5'- ACCATAGTCCCTTTTGTGAAGAC -3'

Sequencing Primer
(F):5'- TGGGCTTCCTCCAACAGAGATAC -3'
(R):5'- CATAGTCCCTTTTGTGAAGACTGCAG -3'
Posted On2018-09-12