Incidental Mutation 'R6848:Opn3'
ID534842
Institutional Source Beutler Lab
Gene Symbol Opn3
Ensembl Gene ENSMUSG00000026525
Gene Nameopsin 3
SynonymsEcpn, encephalopsin, panopsin, ERO
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6848 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location175662421-175692776 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 175663049 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 349 (V349M)
Ref Sequence ENSEMBL: ENSMUSP00000027809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027809] [ENSMUST00000040250] [ENSMUST00000097458] [ENSMUST00000140474]
Predicted Effect probably damaging
Transcript: ENSMUST00000027809
AA Change: V349M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027809
Gene: ENSMUSG00000026525
AA Change: V349M

DomainStartEndE-ValueType
low complexity region 16 26 N/A INTRINSIC
Pfam:7tm_1 56 307 4.7e-36 PFAM
low complexity region 314 331 N/A INTRINSIC
low complexity region 363 375 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000040250
SMART Domains Protein: ENSMUSP00000038914
Gene: ENSMUSG00000039783

DomainStartEndE-ValueType
Pfam:FAD_binding_3 9 328 5.6e-22 PFAM
Pfam:NAD_binding_8 13 63 2.2e-7 PFAM
transmembrane domain 425 447 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097458
SMART Domains Protein: ENSMUSP00000095067
Gene: ENSMUSG00000039783

DomainStartEndE-ValueType
Pfam:FAD_binding_3 9 328 5.8e-22 PFAM
Pfam:NAD_binding_8 13 63 2.1e-7 PFAM
transmembrane domain 391 413 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140474
SMART Domains Protein: ENSMUSP00000122943
Gene: ENSMUSG00000039783

DomainStartEndE-ValueType
Pfam:FAD_binding_3 44 240 2.9e-10 PFAM
Meta Mutation Damage Score 0.0755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Opsins are members of the guanine nucleotide-binding protein (G protein)-coupled receptor superfamily. In addition to the visual opsins, mammals possess several photoreceptive non-visual opsins that are expressed in extraocular tissues. This gene, opsin 3, is strongly expressed in brain and testis and weakly expressed in liver, placenta, heart, lung, skeletal muscle, kidney, and pancreas. The gene may also be expressed in the retina. The protein has the canonical features of a photoreceptive opsin protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice exhibit normal photoentrainment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap1 T C 11: 69,884,661 N290S probably damaging Het
Acox3 G T 5: 35,592,184 G218C probably damaging Het
Acsf3 G A 8: 122,790,590 G375D probably damaging Het
Adamts9 G T 6: 92,863,354 N568K possibly damaging Het
Akr1cl G A 1: 65,024,769 T87I probably damaging Het
Cacna1s G A 1: 136,092,694 R823Q probably benign Het
Casp16-ps A T 17: 23,551,079 C175* probably null Het
Cast T C 13: 74,695,933 K694R possibly damaging Het
Cep70 G A 9: 99,262,901 R100H probably benign Het
Cep72 C T 13: 74,038,276 A259T possibly damaging Het
Chsy1 T A 7: 66,171,037 M340K probably damaging Het
Col27a1 T C 4: 63,302,371 S182P probably benign Het
Crlf2 A C 5: 109,557,031 F103V possibly damaging Het
Dync2h1 T C 9: 7,159,632 N652S probably benign Het
Ephx4 G A 5: 107,426,918 G274D probably damaging Het
Fer T A 17: 63,991,606 F517I probably damaging Het
Fsip2 A T 2: 82,982,787 H3150L probably benign Het
Gata3 T A 2: 9,858,528 N392Y possibly damaging Het
Gm17660 A G 5: 104,074,737 probably benign Het
Gm5136 A T 10: 108,699,590 V168E probably damaging Het
Gria4 C T 9: 4,793,822 V79M probably damaging Het
Grk3 A C 5: 112,985,775 N60K probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Igf1r T G 7: 68,004,179 I155R probably damaging Het
Igsf9 T C 1: 172,495,762 L681P probably damaging Het
Intu T C 3: 40,694,255 M789T probably benign Het
Kit A T 5: 75,607,212 Q85L probably benign Het
Klhdc2 T A 12: 69,308,976 C325* probably null Het
Mcidas A G 13: 112,993,885 E5G probably benign Het
Mcm5 G T 8: 75,127,290 R724L possibly damaging Het
Nrbp2 G A 15: 76,091,483 probably benign Het
Nrg1 A G 8: 31,818,056 I655T probably damaging Het
Nsun4 T C 4: 116,052,934 D143G possibly damaging Het
Olfr214 T C 6: 116,556,775 S117P probably damaging Het
Olfr610 A G 7: 103,506,457 V163A possibly damaging Het
Olfr74 A T 2: 87,974,170 V165E possibly damaging Het
Pank2 C A 2: 131,282,626 L297I probably damaging Het
Pcdh20 T A 14: 88,467,254 E870V probably benign Het
Pdcd6 T A 13: 74,309,840 M71L possibly damaging Het
Phkb A T 8: 86,029,617 I847F probably damaging Het
Psmb1 A G 17: 15,477,247 F202S probably benign Het
Pwp2 C G 10: 78,184,293 probably null Het
Rbms3 A G 9: 117,251,741 Y21H probably damaging Het
Rhbdl1 T A 17: 25,836,184 K17* probably null Het
Rp1l1 C A 14: 64,028,218 Q418K possibly damaging Het
Slc22a4 A T 11: 54,007,789 V159E possibly damaging Het
Spata31d1a T C 13: 59,701,963 T784A possibly damaging Het
Tll1 A G 8: 64,098,510 M279T probably damaging Het
Tmem163 A T 1: 127,551,380 V134D probably damaging Het
Top2b A G 14: 16,409,958 N875S possibly damaging Het
Tpd52l1 T C 10: 31,332,857 E205G probably benign Het
Tpsb2 T A 17: 25,367,828 Y271* probably null Het
Ugt3a1 G A 15: 9,280,052 probably null Het
Vmn2r67 T C 7: 85,152,632 M154V probably benign Het
Zfp740 T G 15: 102,208,808 I89S probably benign Het
Other mutations in Opn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0349:Opn3 UTSW 1 175692304 missense probably damaging 1.00
R0377:Opn3 UTSW 1 175663694 missense probably damaging 1.00
R2040:Opn3 UTSW 1 175663579 missense possibly damaging 0.73
R2351:Opn3 UTSW 1 175692511 missense probably benign
R4868:Opn3 UTSW 1 175663561 missense probably damaging 1.00
R5561:Opn3 UTSW 1 175665587 missense probably damaging 1.00
R6232:Opn3 UTSW 1 175663103 missense probably damaging 0.99
R7275:Opn3 UTSW 1 175665473 missense probably damaging 1.00
R7522:Opn3 UTSW 1 175665623 missense probably benign 0.08
R7774:Opn3 UTSW 1 175662905 missense probably damaging 0.99
R8081:Opn3 UTSW 1 175665569 missense probably damaging 0.96
Z1177:Opn3 UTSW 1 175692663 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CAGGAACATTGTGGTGGCTG -3'
(R):5'- AGATAGACAACTTAGACGAGTGTC -3'

Sequencing Primer
(F):5'- GGCTGATATAGGACTCTGTCTTCC -3'
(R):5'- CTTCTAGCAGACCAGAATTTGAGTCC -3'
Posted On2018-09-12