Mutagenetix > Incidental Mutation

Incidental Mutation 'R6848:Intu'

534847

Institutional Source

Beutler Lab

Gene Symbol

Intu

Ensembl Gene

ENSMUSG00000060798

Gene Name

inturned planar cell polarity protein

Synonyms

Pdzd6, Pdzk6, 9430087H23Rik, 9230116I04Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6848 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

40531286-40704774 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 40694255 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Threonine at position 789 (M789T)

Ref Sequence

ENSEMBL: ENSMUSP00000088725 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091186]

AlphaFold

Q059U7

Predicted Effect

probably benign
Transcript: ENSMUST00000091186
AA Change: M789T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000088725
Gene: ENSMUSG00000060798
AA Change: M789T

Domain	Start	End	E-Value	Type
low complexity region	21	48	N/A	INTRINSIC
low complexity region	64	81	N/A	INTRINSIC
PDZ	187	269	2.09e-3	SMART
low complexity region	459	468	N/A	INTRINSIC
low complexity region	774	784	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000204176

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.2%

Validation Efficiency

98% (54/55)

MGI Phenotype

PHENOTYPE: Homozygous null mice show defective ciliogenesis and neural tube closure, abnormal patterning of the CNS and limbs, polydactyly, edema and death by E16.5. Homozygotes for a hypomorphic allele show defective ciliation and endochondral ossification, stunted growth, polydactyly and postnatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acap1	T	C	11: 69,884,661	N290S	probably damaging	Het
Acox3	G	T	5: 35,592,184	G218C	probably damaging	Het
Acsf3	G	A	8: 122,790,590	G375D	probably damaging	Het
Adamts9	G	T	6: 92,863,354	N568K	possibly damaging	Het
Akr1cl	G	A	1: 65,024,769	T87I	probably damaging	Het
Cacna1s	G	A	1: 136,092,694	R823Q	probably benign	Het
Casp16-ps	A	T	17: 23,551,079	C175*	probably null	Het
Cast	T	C	13: 74,695,933	K694R	possibly damaging	Het
Cep70	G	A	9: 99,262,901	R100H	probably benign	Het
Cep72	C	T	13: 74,038,276	A259T	possibly damaging	Het
Chsy1	T	A	7: 66,171,037	M340K	probably damaging	Het
Col27a1	T	C	4: 63,302,371	S182P	probably benign	Het
Crlf2	A	C	5: 109,557,031	F103V	possibly damaging	Het
Dync2h1	T	C	9: 7,159,632	N652S	probably benign	Het
Ephx4	G	A	5: 107,426,918	G274D	probably damaging	Het
Fer	T	A	17: 63,991,606	F517I	probably damaging	Het
Fsip2	A	T	2: 82,982,787	H3150L	probably benign	Het
Gata3	T	A	2: 9,858,528	N392Y	possibly damaging	Het
Gm17660	A	G	5: 104,074,737		probably benign	Het
Gm5136	A	T	10: 108,699,590	V168E	probably damaging	Het
Gria4	C	T	9: 4,793,822	V79M	probably damaging	Het
Grk3	A	C	5: 112,985,775	N60K	probably damaging	Het
Idh2	TCCCAGG	T	7: 80,098,331		probably benign	Het
Igf1r	T	G	7: 68,004,179	I155R	probably damaging	Het
Igsf9	T	C	1: 172,495,762	L681P	probably damaging	Het
Kit	A	T	5: 75,607,212	Q85L	probably benign	Het
Klhdc2	T	A	12: 69,308,976	C325*	probably null	Het
Mcidas	A	G	13: 112,993,885	E5G	probably benign	Het
Mcm5	G	T	8: 75,127,290	R724L	possibly damaging	Het
Nrbp2	G	A	15: 76,091,483		probably benign	Het
Nrg1	A	G	8: 31,818,056	I655T	probably damaging	Het
Nsun4	T	C	4: 116,052,934	D143G	possibly damaging	Het
Olfr214	T	C	6: 116,556,775	S117P	probably damaging	Het
Olfr610	A	G	7: 103,506,457	V163A	possibly damaging	Het
Olfr74	A	T	2: 87,974,170	V165E	possibly damaging	Het
Opn3	C	T	1: 175,663,049	V349M	probably damaging	Het
Pank2	C	A	2: 131,282,626	L297I	probably damaging	Het
Pcdh20	T	A	14: 88,467,254	E870V	probably benign	Het
Pdcd6	T	A	13: 74,309,840	M71L	possibly damaging	Het
Phkb	A	T	8: 86,029,617	I847F	probably damaging	Het
Psmb1	A	G	17: 15,477,247	F202S	probably benign	Het
Pwp2	C	G	10: 78,184,293		probably null	Het
Rbms3	A	G	9: 117,251,741	Y21H	probably damaging	Het
Rhbdl1	T	A	17: 25,836,184	K17*	probably null	Het
Rp1l1	C	A	14: 64,028,218	Q418K	possibly damaging	Het
Slc22a4	A	T	11: 54,007,789	V159E	possibly damaging	Het
Spata31d1a	T	C	13: 59,701,963	T784A	possibly damaging	Het
Tll1	A	G	8: 64,098,510	M279T	probably damaging	Het
Tmem163	A	T	1: 127,551,380	V134D	probably damaging	Het
Top2b	A	G	14: 16,409,958	N875S	possibly damaging	Het
Tpd52l1	T	C	10: 31,332,857	E205G	probably benign	Het
Tpsb2	T	A	17: 25,367,828	Y271*	probably null	Het
Ugt3a1	G	A	15: 9,280,052		probably null	Het
Vmn2r67	T	C	7: 85,152,632	M154V	probably benign	Het
Zfp740	T	G	15: 102,208,808	I89S	probably benign	Het

Other mutations in Intu

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01292:Intu	APN	3	40664266	missense	probably benign	0.12
IGL01386:Intu	APN	3	40692587	missense	probably damaging	1.00
IGL02645:Intu	APN	3	40701272	missense	probably benign	0.01
IGL02869:Intu	APN	3	40687786	missense	probably damaging	1.00
IGL03263:Intu	APN	3	40672597	nonsense	probably null
H8562:Intu	UTSW	3	40692673	missense	probably damaging	1.00
PIT4495001:Intu	UTSW	3	40697603	missense	probably benign	0.07
R0010:Intu	UTSW	3	40654272	intron	probably benign
R0173:Intu	UTSW	3	40675346	critical splice donor site	probably null
R0426:Intu	UTSW	3	40675305	missense	probably damaging	0.97
R1566:Intu	UTSW	3	40692578	missense	probably damaging	0.99
R1619:Intu	UTSW	3	40697631	nonsense	probably null
R1658:Intu	UTSW	3	40692781	missense	probably benign	0.20
R1701:Intu	UTSW	3	40664264	missense	probably damaging	1.00
R1707:Intu	UTSW	3	40540924	missense	probably benign	0.03
R1707:Intu	UTSW	3	40683501	missense	possibly damaging	0.69
R1867:Intu	UTSW	3	40664335	missense	probably damaging	1.00
R1868:Intu	UTSW	3	40664335	missense	probably damaging	1.00
R2090:Intu	UTSW	3	40683536	missense	probably benign	0.00
R2310:Intu	UTSW	3	40653813	missense	probably benign
R2989:Intu	UTSW	3	40692710	missense	probably benign	0.11
R4168:Intu	UTSW	3	40672623	missense	probably benign	0.00
R4530:Intu	UTSW	3	40683364	missense	possibly damaging	0.95
R5093:Intu	UTSW	3	40692917	missense	probably benign	0.00
R5541:Intu	UTSW	3	40692587	splice site	probably null
R5587:Intu	UTSW	3	40675308	missense	probably damaging	0.99
R5745:Intu	UTSW	3	40692972	splice site	probably null
R5809:Intu	UTSW	3	40679590	missense	probably damaging	0.99
R5939:Intu	UTSW	3	40692584	missense	probably damaging	1.00
R5953:Intu	UTSW	3	40679550	missense	probably damaging	1.00
R6000:Intu	UTSW	3	40654148	nonsense	probably null
R6063:Intu	UTSW	3	40654094	missense	probably damaging	0.97
R6245:Intu	UTSW	3	40675326	missense	probably damaging	0.98
R6310:Intu	UTSW	3	40701291	nonsense	probably null
R6353:Intu	UTSW	3	40653708	missense	probably damaging	1.00
R6451:Intu	UTSW	3	40701293	missense	possibly damaging	0.94
R6660:Intu	UTSW	3	40531951	missense	probably benign	0.00
R7440:Intu	UTSW	3	40697551	missense	probably benign	0.04
R7625:Intu	UTSW	3	40697599	missense	probably benign
R7633:Intu	UTSW	3	40654253	missense	probably damaging	1.00
R7798:Intu	UTSW	3	40691929	missense	probably damaging	1.00
R7877:Intu	UTSW	3	40699792	missense	probably benign	0.07
R7978:Intu	UTSW	3	40697639	missense	probably damaging	1.00
R8319:Intu	UTSW	3	40653772	missense	probably damaging	1.00
R8332:Intu	UTSW	3	40675289	missense	probably benign	0.35
R8860:Intu	UTSW	3	40672732	missense	probably benign	0.07
R8926:Intu	UTSW	3	40653709	missense	possibly damaging	0.69
R8946:Intu	UTSW	3	40683359	missense	possibly damaging	0.93
R9164:Intu	UTSW	3	40690703	missense	probably damaging	1.00
R9191:Intu	UTSW	3	40692511	missense	probably damaging	0.99
R9547:Intu	UTSW	3	40654106	missense	probably benign
Z1177:Intu	UTSW	3	40697516	missense	possibly damaging	0.80

Predicted Primers

PCR Primer
(F):5'- CAAAAGCAGTGCTCTTAGGC -3'
(R):5'- AACCAGGCATCTACTAGAGTGTG -3'

Sequencing Primer
(F):5'- CAGTGCTCTTAGGCTTTAAATTTTTG -3'
(R):5'- GGCATCTACTAGAGTGTGAAATTAG -3'

Posted On

2018-09-12