Incidental Mutation 'R6848:Crlf2'
ID534854
Institutional Source Beutler Lab
Gene Symbol Crlf2
Ensembl Gene ENSMUSG00000033467
Gene Namecytokine receptor-like factor 2
SynonymsLy114, Tpte2, Tslpr
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.455) question?
Stock #R6848 (G1)
Quality Score220.009
Status Validated
Chromosome5
Chromosomal Location109554709-109558993 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 109557031 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 103 (F103V)
Ref Sequence ENSEMBL: ENSMUSP00000143641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044579] [ENSMUST00000198960] [ENSMUST00000200284]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044579
AA Change: F105V

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000036326
Gene: ENSMUSG00000033467
AA Change: F105V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 84 102 N/A INTRINSIC
FN3 117 196 2.58e-4 SMART
low complexity region 210 253 N/A INTRINSIC
low complexity region 335 347 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198960
SMART Domains Protein: ENSMUSP00000142982
Gene: ENSMUSG00000033467

DomainStartEndE-ValueType
Blast:FN3 1 52 2e-30 BLAST
SCOP:d1eerb2 1 65 7e-8 SMART
PDB:4NN7|C 1 66 2e-41 PDB
transmembrane domain 95 117 N/A INTRINSIC
low complexity region 202 214 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000200284
AA Change: F103V

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000143641
Gene: ENSMUSG00000033467
AA Change: F103V

DomainStartEndE-ValueType
low complexity region 82 100 N/A INTRINSIC
FN3 115 194 1.3e-6 SMART
low complexity region 208 251 N/A INTRINSIC
low complexity region 333 345 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type I cytokine receptor family. The encoded protein is a receptor for thymic stromal lymphopoietin (TSLP). Together with the interleukin 7 receptor (IL7R), the encoded protein and TSLP activate STAT3, STAT5, and JAK2 pathways, which control processes such as cell proliferation and development of the hematopoietic system. Rearrangement of this gene with immunoglobulin heavy chain gene (IGH) on chromosome 14, or with P2Y purinoceptor 8 gene (P2RY8) on the same X or Y chromosomes is associated with B-progenitor acute lymphoblastic leukemia (ALL) and Down syndrome ALL. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous null mice are overtly normal and maintain normal lymphopoiesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap1 T C 11: 69,884,661 N290S probably damaging Het
Acox3 G T 5: 35,592,184 G218C probably damaging Het
Acsf3 G A 8: 122,790,590 G375D probably damaging Het
Adamts9 G T 6: 92,863,354 N568K possibly damaging Het
Akr1cl G A 1: 65,024,769 T87I probably damaging Het
Cacna1s G A 1: 136,092,694 R823Q probably benign Het
Casp16-ps A T 17: 23,551,079 C175* probably null Het
Cast T C 13: 74,695,933 K694R possibly damaging Het
Cep70 G A 9: 99,262,901 R100H probably benign Het
Cep72 C T 13: 74,038,276 A259T possibly damaging Het
Chsy1 T A 7: 66,171,037 M340K probably damaging Het
Col27a1 T C 4: 63,302,371 S182P probably benign Het
Dync2h1 T C 9: 7,159,632 N652S probably benign Het
Ephx4 G A 5: 107,426,918 G274D probably damaging Het
Fer T A 17: 63,991,606 F517I probably damaging Het
Fsip2 A T 2: 82,982,787 H3150L probably benign Het
Gata3 T A 2: 9,858,528 N392Y possibly damaging Het
Gm17660 A G 5: 104,074,737 probably benign Het
Gm5136 A T 10: 108,699,590 V168E probably damaging Het
Gria4 C T 9: 4,793,822 V79M probably damaging Het
Grk3 A C 5: 112,985,775 N60K probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Igf1r T G 7: 68,004,179 I155R probably damaging Het
Igsf9 T C 1: 172,495,762 L681P probably damaging Het
Intu T C 3: 40,694,255 M789T probably benign Het
Kit A T 5: 75,607,212 Q85L probably benign Het
Klhdc2 T A 12: 69,308,976 C325* probably null Het
Mcidas A G 13: 112,993,885 E5G probably benign Het
Mcm5 G T 8: 75,127,290 R724L possibly damaging Het
Nrbp2 G A 15: 76,091,483 probably benign Het
Nrg1 A G 8: 31,818,056 I655T probably damaging Het
Nsun4 T C 4: 116,052,934 D143G possibly damaging Het
Olfr214 T C 6: 116,556,775 S117P probably damaging Het
Olfr610 A G 7: 103,506,457 V163A possibly damaging Het
Olfr74 A T 2: 87,974,170 V165E possibly damaging Het
Opn3 C T 1: 175,663,049 V349M probably damaging Het
Pank2 C A 2: 131,282,626 L297I probably damaging Het
Pcdh20 T A 14: 88,467,254 E870V probably benign Het
Pdcd6 T A 13: 74,309,840 M71L possibly damaging Het
Phkb A T 8: 86,029,617 I847F probably damaging Het
Psmb1 A G 17: 15,477,247 F202S probably benign Het
Pwp2 C G 10: 78,184,293 probably null Het
Rbms3 A G 9: 117,251,741 Y21H probably damaging Het
Rhbdl1 T A 17: 25,836,184 K17* probably null Het
Rp1l1 C A 14: 64,028,218 Q418K possibly damaging Het
Slc22a4 A T 11: 54,007,789 V159E possibly damaging Het
Spata31d1a T C 13: 59,701,963 T784A possibly damaging Het
Tll1 A G 8: 64,098,510 M279T probably damaging Het
Tmem163 A T 1: 127,551,380 V134D probably damaging Het
Top2b A G 14: 16,409,958 N875S possibly damaging Het
Tpd52l1 T C 10: 31,332,857 E205G probably benign Het
Tpsb2 T A 17: 25,367,828 Y271* probably null Het
Ugt3a1 G A 15: 9,280,052 probably null Het
Vmn2r67 T C 7: 85,152,632 M154V probably benign Het
Zfp740 T G 15: 102,208,808 I89S probably benign Het
Other mutations in Crlf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Crlf2 APN 5 109557570 missense possibly damaging 0.66
R0623:Crlf2 UTSW 5 109557138 missense probably damaging 0.99
R0623:Crlf2 UTSW 5 109557138 missense probably damaging 0.99
R0732:Crlf2 UTSW 5 109557138 missense probably damaging 0.99
R0898:Crlf2 UTSW 5 109557138 missense probably damaging 0.99
R1277:Crlf2 UTSW 5 109557600 missense possibly damaging 0.46
R1674:Crlf2 UTSW 5 109558803 critical splice donor site probably null
R1912:Crlf2 UTSW 5 109557141 missense possibly damaging 0.83
R5276:Crlf2 UTSW 5 109557635 unclassified probably benign
R5418:Crlf2 UTSW 5 109557033 missense probably benign 0.05
R5984:Crlf2 UTSW 5 109555603 missense probably damaging 1.00
R7437:Crlf2 UTSW 5 109554973 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- ACCAACTTCCCGTCTAAGCG -3'
(R):5'- TTGAGGTGTTGAAATTCAGATGCTC -3'

Sequencing Primer
(F):5'- TCTAAGCGCCGCCCAGTTC -3'
(R):5'- AAATTCAGATGCTCGTGGGC -3'
Posted On2018-09-12