Incidental Mutation 'R6848:Adamts9'
ID534856
Institutional Source Beutler Lab
Gene Symbol Adamts9
Ensembl Gene ENSMUSG00000030022
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 9
Synonyms8430403M15Rik, E030027K14Rik, 1810011L16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6848 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location92772699-92943492 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 92863354 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 568 (N568K)
Ref Sequence ENSEMBL: ENSMUSP00000126498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113438] [ENSMUST00000167391]
Predicted Effect possibly damaging
Transcript: ENSMUST00000113438
AA Change: N1149K

PolyPhen 2 Score 0.840 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109065
Gene: ENSMUSG00000030022
AA Change: N1149K

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Pep_M12B_propep 49 207 1.8e-37 PFAM
low complexity region 234 247 N/A INTRINSIC
Pfam:Reprolysin_5 291 476 7.6e-17 PFAM
Pfam:Reprolysin_4 291 495 2e-11 PFAM
Pfam:Reprolysin 293 499 7.4e-29 PFAM
Pfam:Reprolysin_2 310 489 1e-13 PFAM
Pfam:Reprolysin_3 314 445 1.7e-14 PFAM
TSP1 591 643 2.15e-9 SMART
Pfam:ADAM_spacer1 753 871 7.3e-35 PFAM
TSP1 881 936 1.14e0 SMART
Blast:TSP1 938 993 2e-28 BLAST
TSP1 1000 1054 3.78e-5 SMART
TSP1 1055 1109 5.64e-4 SMART
TSP1 1110 1166 1.25e-5 SMART
TSP1 1186 1240 1.45e-6 SMART
TSP1 1242 1296 4.41e-6 SMART
TSP1 1328 1380 7.06e-5 SMART
TSP1 1381 1436 4.24e-8 SMART
TSP1 1440 1495 8.23e-6 SMART
TSP1 1496 1551 1.23e-4 SMART
TSP1 1552 1609 2e-4 SMART
TSP1 1611 1672 1.25e-5 SMART
TSP1 1676 1730 3.47e-4 SMART
Pfam:GON 1732 1930 1.6e-85 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000167391
AA Change: N568K

PolyPhen 2 Score 0.840 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000126498
Gene: ENSMUSG00000030022
AA Change: N568K

DomainStartEndE-ValueType
TSP1 10 62 2.15e-9 SMART
Pfam:ADAM_spacer1 172 290 6.1e-35 PFAM
TSP1 300 355 1.14e0 SMART
Blast:TSP1 357 412 3e-28 BLAST
TSP1 419 473 3.78e-5 SMART
TSP1 474 528 5.64e-4 SMART
TSP1 529 585 1.25e-5 SMART
TSP1 605 659 1.45e-6 SMART
TSP1 661 715 4.41e-6 SMART
TSP1 747 799 7.06e-5 SMART
TSP1 800 855 4.24e-8 SMART
TSP1 859 914 8.23e-6 SMART
TSP1 915 970 1.23e-4 SMART
TSP1 971 1028 2e-4 SMART
TSP1 1030 1091 1.25e-5 SMART
TSP1 1095 1149 3.47e-4 SMART
Pfam:GON 1150 1350 2.1e-86 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. Members of the ADAMTS family have been implicated in the cleavage of proteoglycans, the control of organ shape during development, and the inhibition of angiogenesis. This gene is localized to chromosome 3p14.3-p14.2, an area known to be lost in hereditary renal tumors. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap1 T C 11: 69,884,661 N290S probably damaging Het
Acox3 G T 5: 35,592,184 G218C probably damaging Het
Acsf3 G A 8: 122,790,590 G375D probably damaging Het
Akr1cl G A 1: 65,024,769 T87I probably damaging Het
Cacna1s G A 1: 136,092,694 R823Q probably benign Het
Casp16-ps A T 17: 23,551,079 C175* probably null Het
Cast T C 13: 74,695,933 K694R possibly damaging Het
Cep70 G A 9: 99,262,901 R100H probably benign Het
Cep72 C T 13: 74,038,276 A259T possibly damaging Het
Chsy1 T A 7: 66,171,037 M340K probably damaging Het
Col27a1 T C 4: 63,302,371 S182P probably benign Het
Crlf2 A C 5: 109,557,031 F103V possibly damaging Het
Dync2h1 T C 9: 7,159,632 N652S probably benign Het
Ephx4 G A 5: 107,426,918 G274D probably damaging Het
Fer T A 17: 63,991,606 F517I probably damaging Het
Fsip2 A T 2: 82,982,787 H3150L probably benign Het
Gata3 T A 2: 9,858,528 N392Y possibly damaging Het
Gm17660 A G 5: 104,074,737 probably benign Het
Gm5136 A T 10: 108,699,590 V168E probably damaging Het
Gria4 C T 9: 4,793,822 V79M probably damaging Het
Grk3 A C 5: 112,985,775 N60K probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Igf1r T G 7: 68,004,179 I155R probably damaging Het
Igsf9 T C 1: 172,495,762 L681P probably damaging Het
Intu T C 3: 40,694,255 M789T probably benign Het
Kit A T 5: 75,607,212 Q85L probably benign Het
Klhdc2 T A 12: 69,308,976 C325* probably null Het
Mcidas A G 13: 112,993,885 E5G probably benign Het
Mcm5 G T 8: 75,127,290 R724L possibly damaging Het
Nrbp2 G A 15: 76,091,483 probably benign Het
Nrg1 A G 8: 31,818,056 I655T probably damaging Het
Nsun4 T C 4: 116,052,934 D143G possibly damaging Het
Olfr214 T C 6: 116,556,775 S117P probably damaging Het
Olfr610 A G 7: 103,506,457 V163A possibly damaging Het
Olfr74 A T 2: 87,974,170 V165E possibly damaging Het
Opn3 C T 1: 175,663,049 V349M probably damaging Het
Pank2 C A 2: 131,282,626 L297I probably damaging Het
Pcdh20 T A 14: 88,467,254 E870V probably benign Het
Pdcd6 T A 13: 74,309,840 M71L possibly damaging Het
Phkb A T 8: 86,029,617 I847F probably damaging Het
Psmb1 A G 17: 15,477,247 F202S probably benign Het
Pwp2 C G 10: 78,184,293 probably null Het
Rbms3 A G 9: 117,251,741 Y21H probably damaging Het
Rhbdl1 T A 17: 25,836,184 K17* probably null Het
Rp1l1 C A 14: 64,028,218 Q418K possibly damaging Het
Slc22a4 A T 11: 54,007,789 V159E possibly damaging Het
Spata31d1a T C 13: 59,701,963 T784A possibly damaging Het
Tll1 A G 8: 64,098,510 M279T probably damaging Het
Tmem163 A T 1: 127,551,380 V134D probably damaging Het
Top2b A G 14: 16,409,958 N875S possibly damaging Het
Tpd52l1 T C 10: 31,332,857 E205G probably benign Het
Tpsb2 T A 17: 25,367,828 Y271* probably null Het
Ugt3a1 G A 15: 9,280,052 probably null Het
Vmn2r67 T C 7: 85,152,632 M154V probably benign Het
Zfp740 T G 15: 102,208,808 I89S probably benign Het
Other mutations in Adamts9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Adamts9 APN 6 92859902 missense possibly damaging 0.90
IGL01352:Adamts9 APN 6 92860174 missense probably benign 0.00
IGL01462:Adamts9 APN 6 92894266 missense probably benign 0.04
IGL01551:Adamts9 APN 6 92807020 missense probably damaging 0.99
IGL01577:Adamts9 APN 6 92858147 splice site probably benign
IGL01638:Adamts9 APN 6 92872428 missense probably benign 0.19
IGL01757:Adamts9 APN 6 92796159 missense probably damaging 1.00
IGL02102:Adamts9 APN 6 92777439 missense probably benign 0.00
IGL02379:Adamts9 APN 6 92797033 missense probably damaging 0.97
IGL02419:Adamts9 APN 6 92796997 missense probably benign 0.04
IGL02554:Adamts9 APN 6 92880847 missense probably benign 0.01
IGL02832:Adamts9 APN 6 92807175 missense probably damaging 1.00
IGL03164:Adamts9 APN 6 92889937 missense probably damaging 1.00
IGL03347:Adamts9 APN 6 92887432 nonsense probably null
IGL03401:Adamts9 APN 6 92786868 missense probably damaging 0.97
Bluebeard UTSW 6 92879959 nonsense probably null
PIT4402001:Adamts9 UTSW 6 92872347 missense probably benign
PIT4458001:Adamts9 UTSW 6 92889905 missense probably damaging 0.99
R0047:Adamts9 UTSW 6 92905306 unclassified probably benign
R0047:Adamts9 UTSW 6 92905306 unclassified probably benign
R0067:Adamts9 UTSW 6 92890167 missense probably damaging 0.98
R0141:Adamts9 UTSW 6 92943085 missense probably benign
R0326:Adamts9 UTSW 6 92858057 nonsense probably null
R0396:Adamts9 UTSW 6 92798005 missense probably benign 0.00
R0490:Adamts9 UTSW 6 92872866 missense probably benign
R0504:Adamts9 UTSW 6 92912645 missense probably damaging 1.00
R0620:Adamts9 UTSW 6 92858113 missense possibly damaging 0.95
R0669:Adamts9 UTSW 6 92880957 missense probably damaging 1.00
R0682:Adamts9 UTSW 6 92903802 missense possibly damaging 0.80
R1412:Adamts9 UTSW 6 92796433 missense probably benign
R1433:Adamts9 UTSW 6 92849290 critical splice donor site probably null
R1558:Adamts9 UTSW 6 92908711 missense possibly damaging 0.87
R1661:Adamts9 UTSW 6 92880623 missense possibly damaging 0.92
R1801:Adamts9 UTSW 6 92863376 missense probably benign 0.27
R1855:Adamts9 UTSW 6 92901369 splice site probably benign
R1887:Adamts9 UTSW 6 92872788 critical splice donor site probably null
R1934:Adamts9 UTSW 6 92943121 missense possibly damaging 0.59
R1956:Adamts9 UTSW 6 92859849 missense probably damaging 1.00
R1986:Adamts9 UTSW 6 92796394 missense probably benign
R2370:Adamts9 UTSW 6 92860203 missense probably damaging 0.99
R2376:Adamts9 UTSW 6 92912831 missense probably benign
R2432:Adamts9 UTSW 6 92857900 missense probably damaging 1.00
R2876:Adamts9 UTSW 6 92795910 splice site probably benign
R3015:Adamts9 UTSW 6 92872932 missense probably benign 0.05
R3611:Adamts9 UTSW 6 92869984 missense probably benign 0.05
R4024:Adamts9 UTSW 6 92872784 splice site probably benign
R4292:Adamts9 UTSW 6 92795996 missense possibly damaging 0.95
R4403:Adamts9 UTSW 6 92859864 missense probably damaging 1.00
R4574:Adamts9 UTSW 6 92879959 nonsense probably null
R4677:Adamts9 UTSW 6 92816606 start codon destroyed probably null
R5114:Adamts9 UTSW 6 92890273 missense probably benign 0.03
R5260:Adamts9 UTSW 6 92807137 missense probably benign 0.00
R5384:Adamts9 UTSW 6 92798018 missense probably damaging 1.00
R5423:Adamts9 UTSW 6 92880697 missense possibly damaging 0.84
R5497:Adamts9 UTSW 6 92854365 missense probably damaging 1.00
R5629:Adamts9 UTSW 6 92798133 missense probably damaging 1.00
R5943:Adamts9 UTSW 6 92903786 missense probably benign 0.02
R6039:Adamts9 UTSW 6 92908546 missense possibly damaging 0.95
R6039:Adamts9 UTSW 6 92908546 missense possibly damaging 0.95
R6051:Adamts9 UTSW 6 92859926 missense possibly damaging 0.83
R6051:Adamts9 UTSW 6 92890118 missense probably damaging 1.00
R6082:Adamts9 UTSW 6 92889949 missense probably damaging 1.00
R6192:Adamts9 UTSW 6 92797021 missense probably damaging 1.00
R6291:Adamts9 UTSW 6 92890120 missense probably damaging 1.00
R6502:Adamts9 UTSW 6 92872335 missense probably damaging 1.00
R6818:Adamts9 UTSW 6 92905191 missense probably damaging 1.00
R7028:Adamts9 UTSW 6 92909793 nonsense probably null
R7095:Adamts9 UTSW 6 92887691 missense probably benign 0.39
R7287:Adamts9 UTSW 6 92890003 missense possibly damaging 0.89
R7294:Adamts9 UTSW 6 92894289 missense probably damaging 1.00
R7313:Adamts9 UTSW 6 92858121 missense probably damaging 1.00
R7581:Adamts9 UTSW 6 92937338 missense probably benign 0.00
R7682:Adamts9 UTSW 6 92880698 missense possibly damaging 0.57
R7691:Adamts9 UTSW 6 92796238 missense probably damaging 1.00
R7791:Adamts9 UTSW 6 92872385 missense probably benign 0.00
R7851:Adamts9 UTSW 6 92908706 missense probably damaging 1.00
R7934:Adamts9 UTSW 6 92908706 missense probably damaging 1.00
R8224:Adamts9 UTSW 6 92796370 missense probably damaging 0.96
RF013:Adamts9 UTSW 6 92943145 missense possibly damaging 0.88
Z1177:Adamts9 UTSW 6 92854346 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGGAGGTTGGATCCTAAATGG -3'
(R):5'- ACACTTTACCTAATCTCTGGGTAC -3'

Sequencing Primer
(F):5'- AGCTCTTCTGCCTTTGGA -3'
(R):5'- CCAGTGTGACAGAAGGAGTTTTCTC -3'
Posted On2018-09-12