Incidental Mutation 'R6848:Olfr214'
ID534857
Institutional Source Beutler Lab
Gene Symbol Olfr214
Ensembl Gene ENSMUSG00000051046
Gene Nameolfactory receptor 214
SynonymsMOR119-1, GA_x54KRFPKN04-58190962-58191900
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.343) question?
Stock #R6848 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location116554235-116560611 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116556775 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 117 (S117P)
Ref Sequence ENSEMBL: ENSMUSP00000150737 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060204] [ENSMUST00000122096] [ENSMUST00000203867] [ENSMUST00000214699] [ENSMUST00000215846] [ENSMUST00000217313]
Predicted Effect probably damaging
Transcript: ENSMUST00000060204
AA Change: S117P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000052730
Gene: ENSMUSG00000051046
AA Change: S117P

DomainStartEndE-ValueType
Pfam:7tm_4 39 316 4.7e-47 PFAM
Pfam:7tm_1 49 298 5.9e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122096
SMART Domains Protein: ENSMUSP00000145194
Gene: ENSMUSG00000107906

DomainStartEndE-ValueType
DEXDc 57 254 2.4e-59 SMART
HELICc 291 372 6.6e-38 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000203867
AA Change: S117P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000145465
Gene: ENSMUSG00000051046
AA Change: S117P

DomainStartEndE-ValueType
Pfam:7tm_4 39 316 4.7e-47 PFAM
Pfam:7tm_1 49 298 5.9e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214699
AA Change: S117P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000215846
AA Change: S117P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000217313
AA Change: S117P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap1 T C 11: 69,884,661 N290S probably damaging Het
Acox3 G T 5: 35,592,184 G218C probably damaging Het
Acsf3 G A 8: 122,790,590 G375D probably damaging Het
Adamts9 G T 6: 92,863,354 N568K possibly damaging Het
Akr1cl G A 1: 65,024,769 T87I probably damaging Het
Cacna1s G A 1: 136,092,694 R823Q probably benign Het
Casp16-ps A T 17: 23,551,079 C175* probably null Het
Cast T C 13: 74,695,933 K694R possibly damaging Het
Cep70 G A 9: 99,262,901 R100H probably benign Het
Cep72 C T 13: 74,038,276 A259T possibly damaging Het
Chsy1 T A 7: 66,171,037 M340K probably damaging Het
Col27a1 T C 4: 63,302,371 S182P probably benign Het
Crlf2 A C 5: 109,557,031 F103V possibly damaging Het
Dync2h1 T C 9: 7,159,632 N652S probably benign Het
Ephx4 G A 5: 107,426,918 G274D probably damaging Het
Fer T A 17: 63,991,606 F517I probably damaging Het
Fsip2 A T 2: 82,982,787 H3150L probably benign Het
Gata3 T A 2: 9,858,528 N392Y possibly damaging Het
Gm17660 A G 5: 104,074,737 probably benign Het
Gm5136 A T 10: 108,699,590 V168E probably damaging Het
Gria4 C T 9: 4,793,822 V79M probably damaging Het
Grk3 A C 5: 112,985,775 N60K probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Igf1r T G 7: 68,004,179 I155R probably damaging Het
Igsf9 T C 1: 172,495,762 L681P probably damaging Het
Intu T C 3: 40,694,255 M789T probably benign Het
Kit A T 5: 75,607,212 Q85L probably benign Het
Klhdc2 T A 12: 69,308,976 C325* probably null Het
Mcidas A G 13: 112,993,885 E5G probably benign Het
Mcm5 G T 8: 75,127,290 R724L possibly damaging Het
Nrbp2 G A 15: 76,091,483 probably benign Het
Nrg1 A G 8: 31,818,056 I655T probably damaging Het
Nsun4 T C 4: 116,052,934 D143G possibly damaging Het
Olfr610 A G 7: 103,506,457 V163A possibly damaging Het
Olfr74 A T 2: 87,974,170 V165E possibly damaging Het
Opn3 C T 1: 175,663,049 V349M probably damaging Het
Pank2 C A 2: 131,282,626 L297I probably damaging Het
Pcdh20 T A 14: 88,467,254 E870V probably benign Het
Pdcd6 T A 13: 74,309,840 M71L possibly damaging Het
Phkb A T 8: 86,029,617 I847F probably damaging Het
Psmb1 A G 17: 15,477,247 F202S probably benign Het
Pwp2 C G 10: 78,184,293 probably null Het
Rbms3 A G 9: 117,251,741 Y21H probably damaging Het
Rhbdl1 T A 17: 25,836,184 K17* probably null Het
Rp1l1 C A 14: 64,028,218 Q418K possibly damaging Het
Slc22a4 A T 11: 54,007,789 V159E possibly damaging Het
Spata31d1a T C 13: 59,701,963 T784A possibly damaging Het
Tll1 A G 8: 64,098,510 M279T probably damaging Het
Tmem163 A T 1: 127,551,380 V134D probably damaging Het
Top2b A G 14: 16,409,958 N875S possibly damaging Het
Tpd52l1 T C 10: 31,332,857 E205G probably benign Het
Tpsb2 T A 17: 25,367,828 Y271* probably null Het
Ugt3a1 G A 15: 9,280,052 probably null Het
Vmn2r67 T C 7: 85,152,632 M154V probably benign Het
Zfp740 T G 15: 102,208,808 I89S probably benign Het
Other mutations in Olfr214
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00951:Olfr214 APN 6 116557066 missense probably benign
IGL01837:Olfr214 APN 6 116556846 nonsense probably null
IGL02523:Olfr214 APN 6 116557093 missense probably benign 0.03
R0027:Olfr214 UTSW 6 116556949 missense probably damaging 0.99
R0616:Olfr214 UTSW 6 116556928 missense probably benign 0.00
R1121:Olfr214 UTSW 6 116557229 missense probably damaging 0.99
R1555:Olfr214 UTSW 6 116556826 missense probably damaging 1.00
R1691:Olfr214 UTSW 6 116556577 missense probably benign 0.00
R2196:Olfr214 UTSW 6 116556617 missense probably damaging 0.99
R3080:Olfr214 UTSW 6 116557217 missense probably damaging 0.98
R5416:Olfr214 UTSW 6 116557205 missense probably damaging 1.00
R5706:Olfr214 UTSW 6 116557113 missense probably damaging 1.00
R7425:Olfr214 UTSW 6 116556437 missense possibly damaging 0.95
R8059:Olfr214 UTSW 6 116556473 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- TATCTGGCCTCAGTCACAGG -3'
(R):5'- AAGACAGCCTGGAAAGCCTC -3'

Sequencing Primer
(F):5'- TATCTGGCCTCAGTCACAGGAAATAC -3'
(R):5'- TCAGAATCACACCGGTTACTAGGATG -3'
Posted On2018-09-12