Incidental Mutation 'R6848:Olfr610'
ID534861
Institutional Source Beutler Lab
Gene Symbol Olfr610
Ensembl Gene ENSMUSG00000045584
Gene Nameolfactory receptor 610
SynonymsMOR9-2, GA_x6K02T2PBJ9-6221839-6220892
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R6848 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location103505375-103512122 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103506457 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 163 (V163A)
Ref Sequence ENSEMBL: ENSMUSP00000150921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063109] [ENSMUST00000217627]
Predicted Effect possibly damaging
Transcript: ENSMUST00000063109
AA Change: V163A

PolyPhen 2 Score 0.503 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000052577
Gene: ENSMUSG00000045584
AA Change: V163A

DomainStartEndE-ValueType
Pfam:7tm_4 33 313 3.5e-106 PFAM
Pfam:7TM_GPCR_Srsx 37 310 1.9e-10 PFAM
Pfam:7tm_1 43 295 1.4e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000217627
AA Change: V163A

PolyPhen 2 Score 0.503 (Sensitivity: 0.88; Specificity: 0.90)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap1 T C 11: 69,884,661 N290S probably damaging Het
Acox3 G T 5: 35,592,184 G218C probably damaging Het
Acsf3 G A 8: 122,790,590 G375D probably damaging Het
Adamts9 G T 6: 92,863,354 N568K possibly damaging Het
Akr1cl G A 1: 65,024,769 T87I probably damaging Het
Cacna1s G A 1: 136,092,694 R823Q probably benign Het
Casp16-ps A T 17: 23,551,079 C175* probably null Het
Cast T C 13: 74,695,933 K694R possibly damaging Het
Cep70 G A 9: 99,262,901 R100H probably benign Het
Cep72 C T 13: 74,038,276 A259T possibly damaging Het
Chsy1 T A 7: 66,171,037 M340K probably damaging Het
Col27a1 T C 4: 63,302,371 S182P probably benign Het
Crlf2 A C 5: 109,557,031 F103V possibly damaging Het
Dync2h1 T C 9: 7,159,632 N652S probably benign Het
Ephx4 G A 5: 107,426,918 G274D probably damaging Het
Fer T A 17: 63,991,606 F517I probably damaging Het
Fsip2 A T 2: 82,982,787 H3150L probably benign Het
Gata3 T A 2: 9,858,528 N392Y possibly damaging Het
Gm17660 A G 5: 104,074,737 probably benign Het
Gm5136 A T 10: 108,699,590 V168E probably damaging Het
Gria4 C T 9: 4,793,822 V79M probably damaging Het
Grk3 A C 5: 112,985,775 N60K probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Igf1r T G 7: 68,004,179 I155R probably damaging Het
Igsf9 T C 1: 172,495,762 L681P probably damaging Het
Intu T C 3: 40,694,255 M789T probably benign Het
Kit A T 5: 75,607,212 Q85L probably benign Het
Klhdc2 T A 12: 69,308,976 C325* probably null Het
Mcidas A G 13: 112,993,885 E5G probably benign Het
Mcm5 G T 8: 75,127,290 R724L possibly damaging Het
Nrbp2 G A 15: 76,091,483 probably benign Het
Nrg1 A G 8: 31,818,056 I655T probably damaging Het
Nsun4 T C 4: 116,052,934 D143G possibly damaging Het
Olfr214 T C 6: 116,556,775 S117P probably damaging Het
Olfr74 A T 2: 87,974,170 V165E possibly damaging Het
Opn3 C T 1: 175,663,049 V349M probably damaging Het
Pank2 C A 2: 131,282,626 L297I probably damaging Het
Pcdh20 T A 14: 88,467,254 E870V probably benign Het
Pdcd6 T A 13: 74,309,840 M71L possibly damaging Het
Phkb A T 8: 86,029,617 I847F probably damaging Het
Psmb1 A G 17: 15,477,247 F202S probably benign Het
Pwp2 C G 10: 78,184,293 probably null Het
Rbms3 A G 9: 117,251,741 Y21H probably damaging Het
Rhbdl1 T A 17: 25,836,184 K17* probably null Het
Rp1l1 C A 14: 64,028,218 Q418K possibly damaging Het
Slc22a4 A T 11: 54,007,789 V159E possibly damaging Het
Spata31d1a T C 13: 59,701,963 T784A possibly damaging Het
Tll1 A G 8: 64,098,510 M279T probably damaging Het
Tmem163 A T 1: 127,551,380 V134D probably damaging Het
Top2b A G 14: 16,409,958 N875S possibly damaging Het
Tpd52l1 T C 10: 31,332,857 E205G probably benign Het
Tpsb2 T A 17: 25,367,828 Y271* probably null Het
Ugt3a1 G A 15: 9,280,052 probably null Het
Vmn2r67 T C 7: 85,152,632 M154V probably benign Het
Zfp740 T G 15: 102,208,808 I89S probably benign Het
Other mutations in Olfr610
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01924:Olfr610 APN 7 103506796 missense possibly damaging 0.67
IGL02179:Olfr610 APN 7 103506727 missense probably damaging 1.00
IGL02303:Olfr610 APN 7 103506088 missense probably benign 0.05
IGL02507:Olfr610 APN 7 103506718 nonsense probably null
IGL02562:Olfr610 APN 7 103506216 nonsense probably null
IGL02806:Olfr610 APN 7 103506003 missense probably benign 0.10
R0743:Olfr610 UTSW 7 103506862 nonsense probably null
R0884:Olfr610 UTSW 7 103506862 nonsense probably null
R1673:Olfr610 UTSW 7 103506689 missense probably damaging 0.99
R1752:Olfr610 UTSW 7 103506558 missense probably benign 0.02
R1800:Olfr610 UTSW 7 103506041 missense possibly damaging 0.89
R2043:Olfr610 UTSW 7 103506943 start codon destroyed probably null 0.98
R2254:Olfr610 UTSW 7 103506064 missense probably damaging 1.00
R2566:Olfr610 UTSW 7 103506160 missense probably benign 0.08
R4433:Olfr610 UTSW 7 103506139 missense probably benign 0.04
R5206:Olfr610 UTSW 7 103506102 nonsense probably null
R5470:Olfr610 UTSW 7 103506509 missense probably benign 0.00
R6020:Olfr610 UTSW 7 103506799 missense probably benign
R7222:Olfr610 UTSW 7 103506457 missense possibly damaging 0.50
R7832:Olfr610 UTSW 7 103506379 missense probably damaging 1.00
R7837:Olfr610 UTSW 7 103506845 missense possibly damaging 0.80
R7893:Olfr610 UTSW 7 103506610 missense possibly damaging 0.86
R7915:Olfr610 UTSW 7 103506379 missense probably damaging 1.00
R7920:Olfr610 UTSW 7 103506845 missense possibly damaging 0.80
R7976:Olfr610 UTSW 7 103506610 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- AAGGCTTTCAATCGCTCAGC -3'
(R):5'- CACACATTTTCAGTCATCGAGTC -3'

Sequencing Primer
(F):5'- GAAGCAATGCTCAGGACTGTCTTC -3'
(R):5'- TTCAGTCATCGAGTCAGCCG -3'
Posted On2018-09-12