Incidental Mutation 'R6848:Tll1'
ID534863
Institutional Source Beutler Lab
Gene Symbol Tll1
Ensembl Gene ENSMUSG00000053626
Gene Nametolloid-like
SynonymsTll-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6848 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location64014931-64206271 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 64098510 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 279 (M279T)
Ref Sequence ENSEMBL: ENSMUSP00000070560 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066166]
Predicted Effect probably damaging
Transcript: ENSMUST00000066166
AA Change: M279T

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000070560
Gene: ENSMUSG00000053626
AA Change: M279T

DomainStartEndE-ValueType
ZnMc 153 295 4.12e-56 SMART
CUB 349 461 4.12e-44 SMART
CUB 462 574 3.81e-48 SMART
EGF_CA 574 615 2.28e-9 SMART
CUB 618 730 9.11e-46 SMART
EGF_CA 730 770 4.25e-9 SMART
CUB 774 886 2.01e-47 SMART
CUB 887 1003 7.19e-35 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an astacin-like, zinc-dependent, metalloprotease that belongs to the peptidase M12A family. This protease processes procollagen C-propeptides, such as chordin, pro-biglycan and pro-lysyl oxidase. Studies in mice suggest that this gene plays multiple roles in the development of mammalian heart, and is essential for the formation of the interventricular septum. Allelic variants of this gene are associated with atrial septal defect type 6. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Homozygous null mice are embryonic lethal with death at midgestation from cardiac failure. Cardiac defects include incomplete formation of the ventricular septum and abnormal positioning of the heart and aorta. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap1 T C 11: 69,884,661 N290S probably damaging Het
Acox3 G T 5: 35,592,184 G218C probably damaging Het
Acsf3 G A 8: 122,790,590 G375D probably damaging Het
Adamts9 G T 6: 92,863,354 N568K possibly damaging Het
Akr1cl G A 1: 65,024,769 T87I probably damaging Het
Cacna1s G A 1: 136,092,694 R823Q probably benign Het
Casp16-ps A T 17: 23,551,079 C175* probably null Het
Cast T C 13: 74,695,933 K694R possibly damaging Het
Cep70 G A 9: 99,262,901 R100H probably benign Het
Cep72 C T 13: 74,038,276 A259T possibly damaging Het
Chsy1 T A 7: 66,171,037 M340K probably damaging Het
Col27a1 T C 4: 63,302,371 S182P probably benign Het
Crlf2 A C 5: 109,557,031 F103V possibly damaging Het
Dync2h1 T C 9: 7,159,632 N652S probably benign Het
Ephx4 G A 5: 107,426,918 G274D probably damaging Het
Fer T A 17: 63,991,606 F517I probably damaging Het
Fsip2 A T 2: 82,982,787 H3150L probably benign Het
Gata3 T A 2: 9,858,528 N392Y possibly damaging Het
Gm17660 A G 5: 104,074,737 probably benign Het
Gm5136 A T 10: 108,699,590 V168E probably damaging Het
Gria4 C T 9: 4,793,822 V79M probably damaging Het
Grk3 A C 5: 112,985,775 N60K probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Igf1r T G 7: 68,004,179 I155R probably damaging Het
Igsf9 T C 1: 172,495,762 L681P probably damaging Het
Intu T C 3: 40,694,255 M789T probably benign Het
Kit A T 5: 75,607,212 Q85L probably benign Het
Klhdc2 T A 12: 69,308,976 C325* probably null Het
Mcidas A G 13: 112,993,885 E5G probably benign Het
Mcm5 G T 8: 75,127,290 R724L possibly damaging Het
Nrbp2 G A 15: 76,091,483 probably benign Het
Nrg1 A G 8: 31,818,056 I655T probably damaging Het
Nsun4 T C 4: 116,052,934 D143G possibly damaging Het
Olfr214 T C 6: 116,556,775 S117P probably damaging Het
Olfr610 A G 7: 103,506,457 V163A possibly damaging Het
Olfr74 A T 2: 87,974,170 V165E possibly damaging Het
Opn3 C T 1: 175,663,049 V349M probably damaging Het
Pank2 C A 2: 131,282,626 L297I probably damaging Het
Pcdh20 T A 14: 88,467,254 E870V probably benign Het
Pdcd6 T A 13: 74,309,840 M71L possibly damaging Het
Phkb A T 8: 86,029,617 I847F probably damaging Het
Psmb1 A G 17: 15,477,247 F202S probably benign Het
Pwp2 C G 10: 78,184,293 probably null Het
Rbms3 A G 9: 117,251,741 Y21H probably damaging Het
Rhbdl1 T A 17: 25,836,184 K17* probably null Het
Rp1l1 C A 14: 64,028,218 Q418K possibly damaging Het
Slc22a4 A T 11: 54,007,789 V159E possibly damaging Het
Spata31d1a T C 13: 59,701,963 T784A possibly damaging Het
Tmem163 A T 1: 127,551,380 V134D probably damaging Het
Top2b A G 14: 16,409,958 N875S possibly damaging Het
Tpd52l1 T C 10: 31,332,857 E205G probably benign Het
Tpsb2 T A 17: 25,367,828 Y271* probably null Het
Ugt3a1 G A 15: 9,280,052 probably null Het
Vmn2r67 T C 7: 85,152,632 M154V probably benign Het
Zfp740 T G 15: 102,208,808 I89S probably benign Het
Other mutations in Tll1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Tll1 APN 8 64016136 missense probably benign
IGL00583:Tll1 APN 8 64205292 missense probably benign
IGL00767:Tll1 APN 8 64071321 missense probably damaging 1.00
IGL01061:Tll1 APN 8 64038454 critical splice donor site probably null
IGL01077:Tll1 APN 8 64070232 missense probably benign 0.27
IGL01536:Tll1 APN 8 64074289 missense probably damaging 1.00
IGL02137:Tll1 APN 8 64016098 missense possibly damaging 0.73
IGL02168:Tll1 APN 8 64053967 missense possibly damaging 0.50
IGL02378:Tll1 APN 8 64017626 nonsense probably null
IGL02469:Tll1 APN 8 64070280 missense probably benign 0.41
IGL02504:Tll1 APN 8 64070237 missense possibly damaging 0.55
IGL02650:Tll1 APN 8 64046997 splice site probably benign
IGL02937:Tll1 APN 8 64205285 nonsense probably null
IGL03006:Tll1 APN 8 64074217 splice site probably benign
R0518:Tll1 UTSW 8 64098471 missense probably damaging 1.00
R0521:Tll1 UTSW 8 64098471 missense probably damaging 1.00
R0541:Tll1 UTSW 8 64038452 splice site probably null
R0612:Tll1 UTSW 8 64071310 missense possibly damaging 0.91
R0690:Tll1 UTSW 8 64074290 missense probably damaging 0.99
R0738:Tll1 UTSW 8 64101950 missense probably damaging 1.00
R1454:Tll1 UTSW 8 64038490 missense probably benign
R1619:Tll1 UTSW 8 64056273 missense probably benign 0.25
R1625:Tll1 UTSW 8 64041442 missense probably damaging 1.00
R1654:Tll1 UTSW 8 64117903 critical splice donor site probably null
R1663:Tll1 UTSW 8 64017686 missense probably benign 0.08
R1681:Tll1 UTSW 8 64085551 missense possibly damaging 0.93
R1713:Tll1 UTSW 8 64101873 missense probably damaging 0.99
R1908:Tll1 UTSW 8 64025107 missense probably damaging 0.98
R2118:Tll1 UTSW 8 64085557 missense probably benign 0.21
R2121:Tll1 UTSW 8 64085557 missense probably benign 0.21
R2124:Tll1 UTSW 8 64085557 missense probably benign 0.21
R2360:Tll1 UTSW 8 64051401 missense probably damaging 1.00
R2396:Tll1 UTSW 8 64070290 nonsense probably null
R3032:Tll1 UTSW 8 64098492 missense probably damaging 0.96
R3115:Tll1 UTSW 8 64053866 missense probably damaging 1.00
R3889:Tll1 UTSW 8 64205224 missense possibly damaging 0.77
R4126:Tll1 UTSW 8 64118014 missense possibly damaging 0.78
R4182:Tll1 UTSW 8 64041511 missense probably damaging 1.00
R4572:Tll1 UTSW 8 64056309 missense possibly damaging 0.81
R4677:Tll1 UTSW 8 64051377 missense probably benign 0.31
R4811:Tll1 UTSW 8 64085473 missense possibly damaging 0.72
R4904:Tll1 UTSW 8 64070199 missense probably benign 0.00
R4992:Tll1 UTSW 8 64093944 missense probably damaging 0.98
R5061:Tll1 UTSW 8 64053949 missense probably damaging 0.99
R5078:Tll1 UTSW 8 64093887 missense probably damaging 1.00
R5208:Tll1 UTSW 8 64051493 missense probably damaging 0.99
R5283:Tll1 UTSW 8 64101966 missense possibly damaging 0.68
R5399:Tll1 UTSW 8 64085488 missense probably damaging 1.00
R5699:Tll1 UTSW 8 64117940 missense probably damaging 0.98
R5986:Tll1 UTSW 8 64074263 missense probably damaging 0.99
R6019:Tll1 UTSW 8 64041491 missense possibly damaging 0.83
R6046:Tll1 UTSW 8 64053891 nonsense probably null
R6083:Tll1 UTSW 8 64038586 splice site probably null
R6125:Tll1 UTSW 8 64051487 missense probably damaging 1.00
R6222:Tll1 UTSW 8 64098534 missense probably benign 0.18
R6275:Tll1 UTSW 8 64051367 nonsense probably null
R6508:Tll1 UTSW 8 64098460 missense probably damaging 0.99
R6758:Tll1 UTSW 8 64041405 critical splice donor site probably null
R6782:Tll1 UTSW 8 64071281 missense probably benign 0.00
R7057:Tll1 UTSW 8 64101881 missense probably damaging 1.00
R7144:Tll1 UTSW 8 64124945 missense possibly damaging 0.90
R7244:Tll1 UTSW 8 64025188 missense probably benign 0.00
R7336:Tll1 UTSW 8 64025142 missense probably damaging 0.98
R7373:Tll1 UTSW 8 64051357 missense probably damaging 0.98
R7626:Tll1 UTSW 8 64098234 intron probably null
R7687:Tll1 UTSW 8 64121492 nonsense probably null
R7699:Tll1 UTSW 8 64093954 missense probably benign 0.00
R7700:Tll1 UTSW 8 64093954 missense probably benign 0.00
R7765:Tll1 UTSW 8 64051449 missense probably damaging 1.00
R7790:Tll1 UTSW 8 64025237 nonsense probably null
X0020:Tll1 UTSW 8 64017628 missense probably damaging 0.97
Z1176:Tll1 UTSW 8 64047163 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTCCACTTTTGACCCAGG -3'
(R):5'- AGAATTAGCTCATTGTTCCACTCC -3'

Sequencing Primer
(F):5'- TGACCCAGGGCAATATTTCTAC -3'
(R):5'- CAACGGCAATACCATATTTC -3'
Posted On2018-09-12