Incidental Mutation 'R6848:Mcm5'
ID534864
Institutional Source Beutler Lab
Gene Symbol Mcm5
Ensembl Gene ENSMUSG00000005410
Gene Nameminichromosome maintenance complex component 5
SynonymsCdc46, mCD46, Mcmd5
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6848 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location75109569-75128439 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 75127290 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 724 (R724L)
Ref Sequence ENSEMBL: ENSMUSP00000148525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164309] [ENSMUST00000212426] [ENSMUST00000212811]
Predicted Effect possibly damaging
Transcript: ENSMUST00000164309
AA Change: R724L

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000126135
Gene: ENSMUSG00000005410
AA Change: R724L

DomainStartEndE-ValueType
MCM 133 649 N/A SMART
Blast:MCM 693 734 2e-7 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000212426
AA Change: R724L

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000212811
AA Change: R724L

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the oligameric minichromosome maintenance protein complex. During DNA replication, the complex loads onto chromatin in early G1 and is converted into an active replicative helicase during S phase. It functions to limit DNA synthesis to once per cell cycle. During embryogenesis, the encoded protein is negatively regulated through expression of paired box protein Pax 3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap1 T C 11: 69,884,661 N290S probably damaging Het
Acox3 G T 5: 35,592,184 G218C probably damaging Het
Acsf3 G A 8: 122,790,590 G375D probably damaging Het
Adamts9 G T 6: 92,863,354 N568K possibly damaging Het
Akr1cl G A 1: 65,024,769 T87I probably damaging Het
Cacna1s G A 1: 136,092,694 R823Q probably benign Het
Casp16-ps A T 17: 23,551,079 C175* probably null Het
Cast T C 13: 74,695,933 K694R possibly damaging Het
Cep70 G A 9: 99,262,901 R100H probably benign Het
Cep72 C T 13: 74,038,276 A259T possibly damaging Het
Chsy1 T A 7: 66,171,037 M340K probably damaging Het
Col27a1 T C 4: 63,302,371 S182P probably benign Het
Crlf2 A C 5: 109,557,031 F103V possibly damaging Het
Dync2h1 T C 9: 7,159,632 N652S probably benign Het
Ephx4 G A 5: 107,426,918 G274D probably damaging Het
Fer T A 17: 63,991,606 F517I probably damaging Het
Fsip2 A T 2: 82,982,787 H3150L probably benign Het
Gata3 T A 2: 9,858,528 N392Y possibly damaging Het
Gm17660 A G 5: 104,074,737 probably benign Het
Gm5136 A T 10: 108,699,590 V168E probably damaging Het
Gria4 C T 9: 4,793,822 V79M probably damaging Het
Grk3 A C 5: 112,985,775 N60K probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Igf1r T G 7: 68,004,179 I155R probably damaging Het
Igsf9 T C 1: 172,495,762 L681P probably damaging Het
Intu T C 3: 40,694,255 M789T probably benign Het
Kit A T 5: 75,607,212 Q85L probably benign Het
Klhdc2 T A 12: 69,308,976 C325* probably null Het
Mcidas A G 13: 112,993,885 E5G probably benign Het
Nrbp2 G A 15: 76,091,483 probably benign Het
Nrg1 A G 8: 31,818,056 I655T probably damaging Het
Nsun4 T C 4: 116,052,934 D143G possibly damaging Het
Olfr214 T C 6: 116,556,775 S117P probably damaging Het
Olfr610 A G 7: 103,506,457 V163A possibly damaging Het
Olfr74 A T 2: 87,974,170 V165E possibly damaging Het
Opn3 C T 1: 175,663,049 V349M probably damaging Het
Pank2 C A 2: 131,282,626 L297I probably damaging Het
Pcdh20 T A 14: 88,467,254 E870V probably benign Het
Pdcd6 T A 13: 74,309,840 M71L possibly damaging Het
Phkb A T 8: 86,029,617 I847F probably damaging Het
Psmb1 A G 17: 15,477,247 F202S probably benign Het
Pwp2 C G 10: 78,184,293 probably null Het
Rbms3 A G 9: 117,251,741 Y21H probably damaging Het
Rhbdl1 T A 17: 25,836,184 K17* probably null Het
Rp1l1 C A 14: 64,028,218 Q418K possibly damaging Het
Slc22a4 A T 11: 54,007,789 V159E possibly damaging Het
Spata31d1a T C 13: 59,701,963 T784A possibly damaging Het
Tll1 A G 8: 64,098,510 M279T probably damaging Het
Tmem163 A T 1: 127,551,380 V134D probably damaging Het
Top2b A G 14: 16,409,958 N875S possibly damaging Het
Tpd52l1 T C 10: 31,332,857 E205G probably benign Het
Tpsb2 T A 17: 25,367,828 Y271* probably null Het
Ugt3a1 G A 15: 9,280,052 probably null Het
Vmn2r67 T C 7: 85,152,632 M154V probably benign Het
Zfp740 T G 15: 102,208,808 I89S probably benign Het
Other mutations in Mcm5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Mcm5 APN 8 75124945 critical splice donor site probably null
IGL00954:Mcm5 APN 8 75110112 missense possibly damaging 0.78
IGL02534:Mcm5 APN 8 75114233 missense probably damaging 1.00
IGL03074:Mcm5 APN 8 75119301 missense possibly damaging 0.94
IGL03176:Mcm5 APN 8 75109853 missense possibly damaging 0.95
IGL03240:Mcm5 APN 8 75115902 missense probably damaging 1.00
PIT4142001:Mcm5 UTSW 8 75127236 missense probably benign
R0133:Mcm5 UTSW 8 75120911 missense probably damaging 1.00
R0138:Mcm5 UTSW 8 75120880 missense probably damaging 1.00
R0226:Mcm5 UTSW 8 75126252 missense possibly damaging 0.90
R0733:Mcm5 UTSW 8 75127248 missense probably benign 0.08
R1217:Mcm5 UTSW 8 75126291 missense probably benign 0.01
R1601:Mcm5 UTSW 8 75119354 missense possibly damaging 0.87
R1834:Mcm5 UTSW 8 75119273 missense possibly damaging 0.64
R1958:Mcm5 UTSW 8 75121629 missense probably benign 0.34
R3410:Mcm5 UTSW 8 75121644 missense possibly damaging 0.88
R4133:Mcm5 UTSW 8 75115854 missense probably damaging 1.00
R4441:Mcm5 UTSW 8 75112544 missense probably benign 0.39
R5395:Mcm5 UTSW 8 75123026 missense probably benign
R5710:Mcm5 UTSW 8 75120910 missense probably damaging 1.00
R5714:Mcm5 UTSW 8 75120910 missense probably damaging 1.00
R6075:Mcm5 UTSW 8 75114197 missense probably damaging 1.00
R6093:Mcm5 UTSW 8 75109746 missense probably benign 0.06
R6477:Mcm5 UTSW 8 75112602 missense probably benign 0.36
R7098:Mcm5 UTSW 8 75120901 missense probably damaging 1.00
R7208:Mcm5 UTSW 8 75121716 critical splice donor site probably null
R7278:Mcm5 UTSW 8 75124859 missense probably benign 0.40
R7552:Mcm5 UTSW 8 75121592 missense probably damaging 0.99
R7701:Mcm5 UTSW 8 75123923 missense probably benign 0.00
Z1177:Mcm5 UTSW 8 75121672 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- CACACTTTTCTGAAGTCAAGGGAG -3'
(R):5'- ACAGTATGAGGCCAACAGAC -3'

Sequencing Primer
(F):5'- CTTTTCTGAAGTCAAGGGAGAATGG -3'
(R):5'- CCAAAGTACATTTCCAGGGGCTG -3'
Posted On2018-09-12