Incidental Mutation 'R6848:Acsf3'
ID534866
Institutional Source Beutler Lab
Gene Symbol Acsf3
Ensembl Gene ENSMUSG00000015016
Gene Nameacyl-CoA synthetase family member 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.443) question?
Stock #R6848 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location122775486-122817880 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 122790590 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 375 (G375D)
Ref Sequence ENSEMBL: ENSMUSP00000148762 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015160] [ENSMUST00000127664] [ENSMUST00000212781] [ENSMUST00000212790]
Predicted Effect probably damaging
Transcript: ENSMUST00000015160
AA Change: G375D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000015160
Gene: ENSMUSG00000015016
AA Change: G375D

DomainStartEndE-ValueType
Pfam:AMP-binding 47 478 3.9e-86 PFAM
Pfam:AMP-binding_C 486 561 6.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000212781
AA Change: G375D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000212790
AA Change: G375D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the acyl-CoA synthetase family of enzymes that activate fatty acids by catalyzing the formation of a thioester linkage between fatty acids and coenzyme A. The encoded protein is localized to mitochondria, has high specificity for malonate and methylmalonate and possesses malonyl-CoA synthetase activity. Mutations in this gene are a cause of combined malonic and methylmalonic aciduria. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap1 T C 11: 69,884,661 N290S probably damaging Het
Acox3 G T 5: 35,592,184 G218C probably damaging Het
Adamts9 G T 6: 92,863,354 N568K possibly damaging Het
Akr1cl G A 1: 65,024,769 T87I probably damaging Het
Cacna1s G A 1: 136,092,694 R823Q probably benign Het
Casp16-ps A T 17: 23,551,079 C175* probably null Het
Cast T C 13: 74,695,933 K694R possibly damaging Het
Cep70 G A 9: 99,262,901 R100H probably benign Het
Cep72 C T 13: 74,038,276 A259T possibly damaging Het
Chsy1 T A 7: 66,171,037 M340K probably damaging Het
Col27a1 T C 4: 63,302,371 S182P probably benign Het
Crlf2 A C 5: 109,557,031 F103V possibly damaging Het
Dync2h1 T C 9: 7,159,632 N652S probably benign Het
Ephx4 G A 5: 107,426,918 G274D probably damaging Het
Fer T A 17: 63,991,606 F517I probably damaging Het
Fsip2 A T 2: 82,982,787 H3150L probably benign Het
Gata3 T A 2: 9,858,528 N392Y possibly damaging Het
Gm17660 A G 5: 104,074,737 probably benign Het
Gm5136 A T 10: 108,699,590 V168E probably damaging Het
Gria4 C T 9: 4,793,822 V79M probably damaging Het
Grk3 A C 5: 112,985,775 N60K probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Igf1r T G 7: 68,004,179 I155R probably damaging Het
Igsf9 T C 1: 172,495,762 L681P probably damaging Het
Intu T C 3: 40,694,255 M789T probably benign Het
Kit A T 5: 75,607,212 Q85L probably benign Het
Klhdc2 T A 12: 69,308,976 C325* probably null Het
Mcidas A G 13: 112,993,885 E5G probably benign Het
Mcm5 G T 8: 75,127,290 R724L possibly damaging Het
Nrbp2 G A 15: 76,091,483 probably benign Het
Nrg1 A G 8: 31,818,056 I655T probably damaging Het
Nsun4 T C 4: 116,052,934 D143G possibly damaging Het
Olfr214 T C 6: 116,556,775 S117P probably damaging Het
Olfr610 A G 7: 103,506,457 V163A possibly damaging Het
Olfr74 A T 2: 87,974,170 V165E possibly damaging Het
Opn3 C T 1: 175,663,049 V349M probably damaging Het
Pank2 C A 2: 131,282,626 L297I probably damaging Het
Pcdh20 T A 14: 88,467,254 E870V probably benign Het
Pdcd6 T A 13: 74,309,840 M71L possibly damaging Het
Phkb A T 8: 86,029,617 I847F probably damaging Het
Psmb1 A G 17: 15,477,247 F202S probably benign Het
Pwp2 C G 10: 78,184,293 probably null Het
Rbms3 A G 9: 117,251,741 Y21H probably damaging Het
Rhbdl1 T A 17: 25,836,184 K17* probably null Het
Rp1l1 C A 14: 64,028,218 Q418K possibly damaging Het
Slc22a4 A T 11: 54,007,789 V159E possibly damaging Het
Spata31d1a T C 13: 59,701,963 T784A possibly damaging Het
Tll1 A G 8: 64,098,510 M279T probably damaging Het
Tmem163 A T 1: 127,551,380 V134D probably damaging Het
Top2b A G 14: 16,409,958 N875S possibly damaging Het
Tpd52l1 T C 10: 31,332,857 E205G probably benign Het
Tpsb2 T A 17: 25,367,828 Y271* probably null Het
Ugt3a1 G A 15: 9,280,052 probably null Het
Vmn2r67 T C 7: 85,152,632 M154V probably benign Het
Zfp740 T G 15: 102,208,808 I89S probably benign Het
Other mutations in Acsf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01288:Acsf3 APN 8 122780642 splice site probably benign
IGL01930:Acsf3 APN 8 122780346 missense probably benign 0.03
IGL02064:Acsf3 APN 8 122780247 missense possibly damaging 0.74
IGL02321:Acsf3 APN 8 122780114 missense possibly damaging 0.57
IGL02342:Acsf3 APN 8 122817498 missense probably benign 0.03
R0233:Acsf3 UTSW 8 122780292 missense probably damaging 1.00
R0233:Acsf3 UTSW 8 122780292 missense probably damaging 1.00
R0240:Acsf3 UTSW 8 122780181 missense probably damaging 1.00
R0240:Acsf3 UTSW 8 122780181 missense probably damaging 1.00
R0566:Acsf3 UTSW 8 122781527 missense possibly damaging 0.95
R1255:Acsf3 UTSW 8 122785966 critical splice donor site probably null
R1836:Acsf3 UTSW 8 122780183 missense probably damaging 0.99
R1886:Acsf3 UTSW 8 122784002 missense probably damaging 1.00
R1977:Acsf3 UTSW 8 122781533 missense probably damaging 1.00
R2204:Acsf3 UTSW 8 122813644 missense probably damaging 0.98
R4735:Acsf3 UTSW 8 122781479 missense probably damaging 1.00
R4795:Acsf3 UTSW 8 122780157 missense possibly damaging 0.59
R4850:Acsf3 UTSW 8 122817436 missense probably damaging 1.00
R5092:Acsf3 UTSW 8 122817392 missense probably benign 0.12
R5435:Acsf3 UTSW 8 122780281 missense probably damaging 1.00
R6115:Acsf3 UTSW 8 122790672 missense probably damaging 1.00
R6147:Acsf3 UTSW 8 122781474 missense probably damaging 1.00
R6283:Acsf3 UTSW 8 122785955 missense probably damaging 1.00
R7268:Acsf3 UTSW 8 122790662 missense probably benign 0.16
R7291:Acsf3 UTSW 8 122813577 missense probably benign 0.03
R7319:Acsf3 UTSW 8 122813031 missense probably damaging 1.00
R7350:Acsf3 UTSW 8 122785946 missense probably benign 0.00
R7402:Acsf3 UTSW 8 122780424 missense probably damaging 1.00
R7890:Acsf3 UTSW 8 122785965 critical splice donor site probably null
R7908:Acsf3 UTSW 8 122785823 missense probably damaging 0.99
R7973:Acsf3 UTSW 8 122785965 critical splice donor site probably null
R7989:Acsf3 UTSW 8 122785823 missense probably damaging 0.99
R8058:Acsf3 UTSW 8 122813634 missense possibly damaging 0.88
Z1177:Acsf3 UTSW 8 122779964 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AGTGAAGAATCCACGTGGC -3'
(R):5'- AGCATCTCTCCTGTCCATGG -3'

Sequencing Primer
(F):5'- AGTGACTCTGGCTGTGCAC -3'
(R):5'- CCTGTCCATGGCTGCCC -3'
Posted On2018-09-12