Incidental Mutation 'R6848:Rbms3'
ID534870
Institutional Source Beutler Lab
Gene Symbol Rbms3
Ensembl Gene ENSMUSG00000039607
Gene NameRNA binding motif, single stranded interacting protein
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R6848 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location116572746-117629913 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 117251741 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 21 (Y21H)
Ref Sequence ENSEMBL: ENSMUSP00000133621 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044901] [ENSMUST00000068962] [ENSMUST00000111772] [ENSMUST00000111773] [ENSMUST00000164018] [ENSMUST00000172564] [ENSMUST00000174868]
Predicted Effect probably damaging
Transcript: ENSMUST00000044901
AA Change: Y21H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000039706
Gene: ENSMUSG00000039607
AA Change: Y21H

DomainStartEndE-ValueType
low complexity region 27 49 N/A INTRINSIC
RRM 57 125 1.2e-17 SMART
RRM 136 208 1.49e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000068962
AA Change: Y21H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000066735
Gene: ENSMUSG00000039607
AA Change: Y21H

DomainStartEndE-ValueType
low complexity region 27 49 N/A INTRINSIC
RRM 57 125 1.2e-17 SMART
RRM 136 208 1.49e-13 SMART
low complexity region 384 394 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111772
AA Change: Y21H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107402
Gene: ENSMUSG00000039607
AA Change: Y21H

DomainStartEndE-ValueType
low complexity region 27 49 N/A INTRINSIC
RRM 57 125 1.2e-17 SMART
RRM 136 208 1.49e-13 SMART
low complexity region 385 395 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111773
AA Change: Y21H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107403
Gene: ENSMUSG00000039607
AA Change: Y21H

DomainStartEndE-ValueType
low complexity region 27 49 N/A INTRINSIC
RRM 57 125 1.2e-17 SMART
RRM 136 208 1.49e-13 SMART
low complexity region 401 411 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164018
SMART Domains Protein: ENSMUSP00000131371
Gene: ENSMUSG00000039607

DomainStartEndE-ValueType
low complexity region 76 98 N/A INTRINSIC
RRM 106 174 1.2e-17 SMART
RRM 185 257 1.49e-13 SMART
low complexity region 433 443 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000172564
AA Change: Y21H

PolyPhen 2 Score 0.641 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000134528
Gene: ENSMUSG00000039607
AA Change: Y21H

DomainStartEndE-ValueType
low complexity region 26 48 N/A INTRINSIC
RRM 56 124 1.2e-17 SMART
RRM 135 204 4.78e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000174868
AA Change: Y21H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133621
Gene: ENSMUSG00000039607
AA Change: Y21H

DomainStartEndE-ValueType
low complexity region 27 49 N/A INTRINSIC
RRM 57 125 1.2e-17 SMART
RRM 136 208 1.49e-13 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA-binding protein that belongs to the c-myc gene single-strand binding protein family. These proteins are characterized by the presence of two sets of ribonucleoprotein consensus sequence (RNP-CS) that contain conserved motifs, RNP1 and RNP2, originally described in RNA binding proteins, and required for DNA binding. These proteins have been implicated in such diverse functions as DNA replication, gene transcription, cell cycle progression and apoptosis. The encoded protein was isolated by virtue of its binding to an upstream element of the alpha2(I) collagen promoter. The observation that this protein localizes mostly in the cytoplasm suggests that it may be involved in a cytoplasmic function such as controlling RNA metabolism, rather than transcription. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap1 T C 11: 69,884,661 N290S probably damaging Het
Acox3 G T 5: 35,592,184 G218C probably damaging Het
Acsf3 G A 8: 122,790,590 G375D probably damaging Het
Adamts9 G T 6: 92,863,354 N568K possibly damaging Het
Akr1cl G A 1: 65,024,769 T87I probably damaging Het
Cacna1s G A 1: 136,092,694 R823Q probably benign Het
Casp16-ps A T 17: 23,551,079 C175* probably null Het
Cast T C 13: 74,695,933 K694R possibly damaging Het
Cep70 G A 9: 99,262,901 R100H probably benign Het
Cep72 C T 13: 74,038,276 A259T possibly damaging Het
Chsy1 T A 7: 66,171,037 M340K probably damaging Het
Col27a1 T C 4: 63,302,371 S182P probably benign Het
Crlf2 A C 5: 109,557,031 F103V possibly damaging Het
Dync2h1 T C 9: 7,159,632 N652S probably benign Het
Ephx4 G A 5: 107,426,918 G274D probably damaging Het
Fer T A 17: 63,991,606 F517I probably damaging Het
Fsip2 A T 2: 82,982,787 H3150L probably benign Het
Gata3 T A 2: 9,858,528 N392Y possibly damaging Het
Gm17660 A G 5: 104,074,737 probably benign Het
Gm5136 A T 10: 108,699,590 V168E probably damaging Het
Gria4 C T 9: 4,793,822 V79M probably damaging Het
Grk3 A C 5: 112,985,775 N60K probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Igf1r T G 7: 68,004,179 I155R probably damaging Het
Igsf9 T C 1: 172,495,762 L681P probably damaging Het
Intu T C 3: 40,694,255 M789T probably benign Het
Kit A T 5: 75,607,212 Q85L probably benign Het
Klhdc2 T A 12: 69,308,976 C325* probably null Het
Mcidas A G 13: 112,993,885 E5G probably benign Het
Mcm5 G T 8: 75,127,290 R724L possibly damaging Het
Nrbp2 G A 15: 76,091,483 probably benign Het
Nrg1 A G 8: 31,818,056 I655T probably damaging Het
Nsun4 T C 4: 116,052,934 D143G possibly damaging Het
Olfr214 T C 6: 116,556,775 S117P probably damaging Het
Olfr610 A G 7: 103,506,457 V163A possibly damaging Het
Olfr74 A T 2: 87,974,170 V165E possibly damaging Het
Opn3 C T 1: 175,663,049 V349M probably damaging Het
Pank2 C A 2: 131,282,626 L297I probably damaging Het
Pcdh20 T A 14: 88,467,254 E870V probably benign Het
Pdcd6 T A 13: 74,309,840 M71L possibly damaging Het
Phkb A T 8: 86,029,617 I847F probably damaging Het
Psmb1 A G 17: 15,477,247 F202S probably benign Het
Pwp2 C G 10: 78,184,293 probably null Het
Rhbdl1 T A 17: 25,836,184 K17* probably null Het
Rp1l1 C A 14: 64,028,218 Q418K possibly damaging Het
Slc22a4 A T 11: 54,007,789 V159E possibly damaging Het
Spata31d1a T C 13: 59,701,963 T784A possibly damaging Het
Tll1 A G 8: 64,098,510 M279T probably damaging Het
Tmem163 A T 1: 127,551,380 V134D probably damaging Het
Top2b A G 14: 16,409,958 N875S possibly damaging Het
Tpd52l1 T C 10: 31,332,857 E205G probably benign Het
Tpsb2 T A 17: 25,367,828 Y271* probably null Het
Ugt3a1 G A 15: 9,280,052 probably null Het
Vmn2r67 T C 7: 85,152,632 M154V probably benign Het
Zfp740 T G 15: 102,208,808 I89S probably benign Het
Other mutations in Rbms3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00917:Rbms3 APN 9 117110115 missense probably damaging 0.99
IGL01859:Rbms3 APN 9 116959538 missense probably damaging 1.00
IGL01962:Rbms3 APN 9 116695811 splice site probably benign
IGL03034:Rbms3 APN 9 117251811 utr 5 prime probably benign
PIT4810001:Rbms3 UTSW 9 117056793 missense probably damaging 0.98
R0862:Rbms3 UTSW 9 117629792 splice site probably benign
R0864:Rbms3 UTSW 9 117629792 splice site probably benign
R0939:Rbms3 UTSW 9 117109960 critical splice donor site probably null
R1796:Rbms3 UTSW 9 116719333 missense probably damaging 1.00
R1808:Rbms3 UTSW 9 116822826 missense probably damaging 1.00
R1826:Rbms3 UTSW 9 116822868 missense probably damaging 1.00
R2213:Rbms3 UTSW 9 116959466 critical splice donor site probably null
R3719:Rbms3 UTSW 9 116582862 missense probably benign 0.11
R3935:Rbms3 UTSW 9 116636391 missense probably damaging 1.00
R4270:Rbms3 UTSW 9 117056748 missense probably damaging 1.00
R4822:Rbms3 UTSW 9 116944373 intron probably benign
R4943:Rbms3 UTSW 9 116678505 intron probably benign
R5445:Rbms3 UTSW 9 117251785 missense possibly damaging 0.74
R5997:Rbms3 UTSW 9 116719389 missense probably damaging 1.00
R6944:Rbms3 UTSW 9 117110105 missense probably damaging 0.99
R7205:Rbms3 UTSW 9 116586017 critical splice donor site probably null
R7419:Rbms3 UTSW 9 116822826 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCCCCTGTCTTTAAAGAGAAAGC -3'
(R):5'- TGAGAAGCCTCAGCAGTCAC -3'

Sequencing Primer
(F):5'- AAAGCTACACTCCGGGGCTTC -3'
(R):5'- TCACGCAGACTGCCAGG -3'
Posted On2018-09-12