Incidental Mutation 'R6848:Tpd52l1'
ID534871
Institutional Source Beutler Lab
Gene Symbol Tpd52l1
Ensembl Gene ENSMUSG00000000296
Gene Nametumor protein D52-like 1
SynonymsD53
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6848 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location31332376-31445958 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31332857 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 205 (E205G)
Ref Sequence ENSEMBL: ENSMUSP00000149177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000304] [ENSMUST00000000305] [ENSMUST00000159194] [ENSMUST00000213528] [ENSMUST00000213639] [ENSMUST00000214644] [ENSMUST00000215515]
Predicted Effect probably benign
Transcript: ENSMUST00000000304
SMART Domains Protein: ENSMUSP00000000304
Gene: ENSMUSG00000000295

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
HDc 37 152 3.51e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000000305
AA Change: E200G

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000000305
Gene: ENSMUSG00000000296
AA Change: E200G

DomainStartEndE-ValueType
Pfam:TPD52 9 187 1.3e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159194
SMART Domains Protein: ENSMUSP00000124106
Gene: ENSMUSG00000000295

DomainStartEndE-ValueType
Pfam:HD_3 1 100 1.5e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213528
AA Change: E205G

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000213639
AA Change: E187G

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000214644
Predicted Effect probably benign
Transcript: ENSMUST00000215515
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that contain coiled-coil domains and may form hetero- or homomers. The encoded protein is involved in cell proliferation and calcium signaling. It also interacts with the mitogen-activated protein kinase kinase kinase 5 (MAP3K5/ASK1) and positively regulates MAP3K5-induced apoptosis. Multiple alternatively spliced transcript variants have been observed. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap1 T C 11: 69,884,661 N290S probably damaging Het
Acox3 G T 5: 35,592,184 G218C probably damaging Het
Acsf3 G A 8: 122,790,590 G375D probably damaging Het
Adamts9 G T 6: 92,863,354 N568K possibly damaging Het
Akr1cl G A 1: 65,024,769 T87I probably damaging Het
Cacna1s G A 1: 136,092,694 R823Q probably benign Het
Casp16-ps A T 17: 23,551,079 C175* probably null Het
Cast T C 13: 74,695,933 K694R possibly damaging Het
Cep70 G A 9: 99,262,901 R100H probably benign Het
Cep72 C T 13: 74,038,276 A259T possibly damaging Het
Chsy1 T A 7: 66,171,037 M340K probably damaging Het
Col27a1 T C 4: 63,302,371 S182P probably benign Het
Crlf2 A C 5: 109,557,031 F103V possibly damaging Het
Dync2h1 T C 9: 7,159,632 N652S probably benign Het
Ephx4 G A 5: 107,426,918 G274D probably damaging Het
Fer T A 17: 63,991,606 F517I probably damaging Het
Fsip2 A T 2: 82,982,787 H3150L probably benign Het
Gata3 T A 2: 9,858,528 N392Y possibly damaging Het
Gm17660 A G 5: 104,074,737 probably benign Het
Gm5136 A T 10: 108,699,590 V168E probably damaging Het
Gria4 C T 9: 4,793,822 V79M probably damaging Het
Grk3 A C 5: 112,985,775 N60K probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Igf1r T G 7: 68,004,179 I155R probably damaging Het
Igsf9 T C 1: 172,495,762 L681P probably damaging Het
Intu T C 3: 40,694,255 M789T probably benign Het
Kit A T 5: 75,607,212 Q85L probably benign Het
Klhdc2 T A 12: 69,308,976 C325* probably null Het
Mcidas A G 13: 112,993,885 E5G probably benign Het
Mcm5 G T 8: 75,127,290 R724L possibly damaging Het
Nrbp2 G A 15: 76,091,483 probably benign Het
Nrg1 A G 8: 31,818,056 I655T probably damaging Het
Nsun4 T C 4: 116,052,934 D143G possibly damaging Het
Olfr214 T C 6: 116,556,775 S117P probably damaging Het
Olfr610 A G 7: 103,506,457 V163A possibly damaging Het
Olfr74 A T 2: 87,974,170 V165E possibly damaging Het
Opn3 C T 1: 175,663,049 V349M probably damaging Het
Pank2 C A 2: 131,282,626 L297I probably damaging Het
Pcdh20 T A 14: 88,467,254 E870V probably benign Het
Pdcd6 T A 13: 74,309,840 M71L possibly damaging Het
Phkb A T 8: 86,029,617 I847F probably damaging Het
Psmb1 A G 17: 15,477,247 F202S probably benign Het
Pwp2 C G 10: 78,184,293 probably null Het
Rbms3 A G 9: 117,251,741 Y21H probably damaging Het
Rhbdl1 T A 17: 25,836,184 K17* probably null Het
Rp1l1 C A 14: 64,028,218 Q418K possibly damaging Het
Slc22a4 A T 11: 54,007,789 V159E possibly damaging Het
Spata31d1a T C 13: 59,701,963 T784A possibly damaging Het
Tll1 A G 8: 64,098,510 M279T probably damaging Het
Tmem163 A T 1: 127,551,380 V134D probably damaging Het
Top2b A G 14: 16,409,958 N875S possibly damaging Het
Tpsb2 T A 17: 25,367,828 Y271* probably null Het
Ugt3a1 G A 15: 9,280,052 probably null Het
Vmn2r67 T C 7: 85,152,632 M154V probably benign Het
Zfp740 T G 15: 102,208,808 I89S probably benign Het
Other mutations in Tpd52l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0123:Tpd52l1 UTSW 10 31379256 missense probably damaging 1.00
R0134:Tpd52l1 UTSW 10 31379256 missense probably damaging 1.00
R0225:Tpd52l1 UTSW 10 31379256 missense probably damaging 1.00
R4411:Tpd52l1 UTSW 10 31379319 missense possibly damaging 0.88
R4828:Tpd52l1 UTSW 10 31346701 missense probably damaging 1.00
R5073:Tpd52l1 UTSW 10 31357920 missense probably damaging 1.00
R5925:Tpd52l1 UTSW 10 31332947 missense probably benign 0.18
R6332:Tpd52l1 UTSW 10 31338207 missense probably damaging 1.00
R6906:Tpd52l1 UTSW 10 31332954 missense possibly damaging 0.47
R7900:Tpd52l1 UTSW 10 31338182 splice site probably null
R7983:Tpd52l1 UTSW 10 31338182 splice site probably null
R8010:Tpd52l1 UTSW 10 31358013 missense possibly damaging 0.89
R8011:Tpd52l1 UTSW 10 31332917 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTAGTGGTCATCAACACAAATGC -3'
(R):5'- GTGCCTCTGAAGAAAATTGGTTATG -3'

Sequencing Primer
(F):5'- GTGGTCATCAACACAAATGCAAAAAG -3'
(R):5'- CTCAAAGGAAATTAAACTTTTGGCAC -3'
Posted On2018-09-12