Incidental Mutation 'R6848:Cep72'
ID534878
Institutional Source Beutler Lab
Gene Symbol Cep72
Ensembl Gene ENSMUSG00000021572
Gene Namecentrosomal protein 72
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R6848 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location74036500-74062299 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 74038276 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 259 (A259T)
Ref Sequence ENSEMBL: ENSMUSP00000152484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022057] [ENSMUST00000036456] [ENSMUST00000221122] [ENSMUST00000222609]
Predicted Effect probably benign
Transcript: ENSMUST00000022057
SMART Domains Protein: ENSMUSP00000022057
Gene: ENSMUSG00000021573

DomainStartEndE-ValueType
low complexity region 5 20 N/A INTRINSIC
Pfam:p25-alpha 51 212 3.7e-73 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000036456
AA Change: A610T

PolyPhen 2 Score 0.797 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000037788
Gene: ENSMUSG00000021572
AA Change: A610T

DomainStartEndE-ValueType
LRR 52 73 2.92e1 SMART
LRR 74 96 5.34e-1 SMART
LRRcap 116 134 1.89e-4 SMART
low complexity region 307 319 N/A INTRINSIC
low complexity region 378 389 N/A INTRINSIC
low complexity region 417 428 N/A INTRINSIC
coiled coil region 485 531 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000221122
AA Change: A259T

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000222609
Predicted Effect probably benign
Transcript: ENSMUST00000223028
Meta Mutation Damage Score 0.1160 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a member of the leucine-rich-repeat (LRR) superfamily of proteins. The protein is localized to the centrosome, a non-membraneous organelle that functions as the major microtubule-organizing center in animal cells. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap1 T C 11: 69,884,661 N290S probably damaging Het
Acox3 G T 5: 35,592,184 G218C probably damaging Het
Acsf3 G A 8: 122,790,590 G375D probably damaging Het
Adamts9 G T 6: 92,863,354 N568K possibly damaging Het
Akr1cl G A 1: 65,024,769 T87I probably damaging Het
Cacna1s G A 1: 136,092,694 R823Q probably benign Het
Casp16-ps A T 17: 23,551,079 C175* probably null Het
Cast T C 13: 74,695,933 K694R possibly damaging Het
Cep70 G A 9: 99,262,901 R100H probably benign Het
Chsy1 T A 7: 66,171,037 M340K probably damaging Het
Col27a1 T C 4: 63,302,371 S182P probably benign Het
Crlf2 A C 5: 109,557,031 F103V possibly damaging Het
Dync2h1 T C 9: 7,159,632 N652S probably benign Het
Ephx4 G A 5: 107,426,918 G274D probably damaging Het
Fer T A 17: 63,991,606 F517I probably damaging Het
Fsip2 A T 2: 82,982,787 H3150L probably benign Het
Gata3 T A 2: 9,858,528 N392Y possibly damaging Het
Gm17660 A G 5: 104,074,737 probably benign Het
Gm5136 A T 10: 108,699,590 V168E probably damaging Het
Gria4 C T 9: 4,793,822 V79M probably damaging Het
Grk3 A C 5: 112,985,775 N60K probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Igf1r T G 7: 68,004,179 I155R probably damaging Het
Igsf9 T C 1: 172,495,762 L681P probably damaging Het
Intu T C 3: 40,694,255 M789T probably benign Het
Kit A T 5: 75,607,212 Q85L probably benign Het
Klhdc2 T A 12: 69,308,976 C325* probably null Het
Mcidas A G 13: 112,993,885 E5G probably benign Het
Mcm5 G T 8: 75,127,290 R724L possibly damaging Het
Nrbp2 G A 15: 76,091,483 probably benign Het
Nrg1 A G 8: 31,818,056 I655T probably damaging Het
Nsun4 T C 4: 116,052,934 D143G possibly damaging Het
Olfr214 T C 6: 116,556,775 S117P probably damaging Het
Olfr610 A G 7: 103,506,457 V163A possibly damaging Het
Olfr74 A T 2: 87,974,170 V165E possibly damaging Het
Opn3 C T 1: 175,663,049 V349M probably damaging Het
Pank2 C A 2: 131,282,626 L297I probably damaging Het
Pcdh20 T A 14: 88,467,254 E870V probably benign Het
Pdcd6 T A 13: 74,309,840 M71L possibly damaging Het
Phkb A T 8: 86,029,617 I847F probably damaging Het
Psmb1 A G 17: 15,477,247 F202S probably benign Het
Pwp2 C G 10: 78,184,293 probably null Het
Rbms3 A G 9: 117,251,741 Y21H probably damaging Het
Rhbdl1 T A 17: 25,836,184 K17* probably null Het
Rp1l1 C A 14: 64,028,218 Q418K possibly damaging Het
Slc22a4 A T 11: 54,007,789 V159E possibly damaging Het
Spata31d1a T C 13: 59,701,963 T784A possibly damaging Het
Tll1 A G 8: 64,098,510 M279T probably damaging Het
Tmem163 A T 1: 127,551,380 V134D probably damaging Het
Top2b A G 14: 16,409,958 N875S possibly damaging Het
Tpd52l1 T C 10: 31,332,857 E205G probably benign Het
Tpsb2 T A 17: 25,367,828 Y271* probably null Het
Ugt3a1 G A 15: 9,280,052 probably null Het
Vmn2r67 T C 7: 85,152,632 M154V probably benign Het
Zfp740 T G 15: 102,208,808 I89S probably benign Het
Other mutations in Cep72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Cep72 APN 13 74062268 unclassified probably benign
IGL01373:Cep72 APN 13 74059459 missense probably damaging 1.00
IGL02415:Cep72 APN 13 74050154 missense probably benign 0.31
IGL03372:Cep72 APN 13 74043518 missense possibly damaging 0.47
R0608:Cep72 UTSW 13 74038304 missense probably damaging 1.00
R0884:Cep72 UTSW 13 74054881 critical splice donor site probably null
R2400:Cep72 UTSW 13 74048977 missense probably damaging 0.99
R4906:Cep72 UTSW 13 74059465 missense probably damaging 1.00
R5534:Cep72 UTSW 13 74062216 missense probably benign 0.05
R5567:Cep72 UTSW 13 74040141 missense probably benign 0.00
R5570:Cep72 UTSW 13 74040141 missense probably benign 0.00
R5816:Cep72 UTSW 13 74049031 missense probably benign 0.43
R6310:Cep72 UTSW 13 74053025 missense possibly damaging 0.94
R6513:Cep72 UTSW 13 74058463 missense probably damaging 1.00
R6936:Cep72 UTSW 13 74040087 missense probably damaging 1.00
R7000:Cep72 UTSW 13 74058325 missense probably damaging 0.96
R7006:Cep72 UTSW 13 74050308 nonsense probably null
R7074:Cep72 UTSW 13 74051580 missense probably benign 0.16
R7640:Cep72 UTSW 13 74058488 nonsense probably null
R7889:Cep72 UTSW 13 74050122 missense possibly damaging 0.84
R7972:Cep72 UTSW 13 74050122 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- GGGTACTTAGATAGATGCATGCCC -3'
(R):5'- TGATAGCCTTGCACTGCTACAG -3'

Sequencing Primer
(F):5'- CTTAGATAGATGCATGCCCAGGTAC -3'
(R):5'- CACTGCTACAGTTAGGAGCATCTG -3'
Posted On2018-09-12