Incidental Mutation 'R6848:Pdcd6'
ID534879
Institutional Source Beutler Lab
Gene Symbol Pdcd6
Ensembl Gene ENSMUSG00000021576
Gene Nameprogrammed cell death 6
SynonymsPS2, Alg2, alg-2, MA-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6848 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location74303509-74317580 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 74309840 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 71 (M71L)
Ref Sequence ENSEMBL: ENSMUSP00000152458 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022060] [ENSMUST00000222759]
Predicted Effect probably benign
Transcript: ENSMUST00000022060
AA Change: M71L

PolyPhen 2 Score 0.427 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000022060
Gene: ENSMUSG00000021576
AA Change: M71L

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
EFh 27 55 1.76e0 SMART
EFh 64 92 2.98e1 SMART
EFh 94 122 1.4e-5 SMART
EFh 130 158 8.33e1 SMART
EFh 160 190 6.2e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000222759
AA Change: M71L

PolyPhen 2 Score 0.562 (Sensitivity: 0.88; Specificity: 0.91)
Meta Mutation Damage Score 0.3703 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a calcium-binding protein belonging to the penta-EF-hand protein family. Calcium binding is important for homodimerization and for conformational changes required for binding to other protein partners. This gene product participates in T cell receptor-, Fas-, and glucocorticoid-induced programmed cell death. In mice deficient for this gene product, however, apoptosis was not blocked suggesting this gene product is functionally redundant. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is also located on the short arm of chromosome 5. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile and do not exhibit any developmental defects or immune dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap1 T C 11: 69,884,661 N290S probably damaging Het
Acox3 G T 5: 35,592,184 G218C probably damaging Het
Acsf3 G A 8: 122,790,590 G375D probably damaging Het
Adamts9 G T 6: 92,863,354 N568K possibly damaging Het
Akr1cl G A 1: 65,024,769 T87I probably damaging Het
Cacna1s G A 1: 136,092,694 R823Q probably benign Het
Casp16-ps A T 17: 23,551,079 C175* probably null Het
Cast T C 13: 74,695,933 K694R possibly damaging Het
Cep70 G A 9: 99,262,901 R100H probably benign Het
Cep72 C T 13: 74,038,276 A259T possibly damaging Het
Chsy1 T A 7: 66,171,037 M340K probably damaging Het
Col27a1 T C 4: 63,302,371 S182P probably benign Het
Crlf2 A C 5: 109,557,031 F103V possibly damaging Het
Dync2h1 T C 9: 7,159,632 N652S probably benign Het
Ephx4 G A 5: 107,426,918 G274D probably damaging Het
Fer T A 17: 63,991,606 F517I probably damaging Het
Fsip2 A T 2: 82,982,787 H3150L probably benign Het
Gata3 T A 2: 9,858,528 N392Y possibly damaging Het
Gm17660 A G 5: 104,074,737 probably benign Het
Gm5136 A T 10: 108,699,590 V168E probably damaging Het
Gria4 C T 9: 4,793,822 V79M probably damaging Het
Grk3 A C 5: 112,985,775 N60K probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Igf1r T G 7: 68,004,179 I155R probably damaging Het
Igsf9 T C 1: 172,495,762 L681P probably damaging Het
Intu T C 3: 40,694,255 M789T probably benign Het
Kit A T 5: 75,607,212 Q85L probably benign Het
Klhdc2 T A 12: 69,308,976 C325* probably null Het
Mcidas A G 13: 112,993,885 E5G probably benign Het
Mcm5 G T 8: 75,127,290 R724L possibly damaging Het
Nrbp2 G A 15: 76,091,483 probably benign Het
Nrg1 A G 8: 31,818,056 I655T probably damaging Het
Nsun4 T C 4: 116,052,934 D143G possibly damaging Het
Olfr214 T C 6: 116,556,775 S117P probably damaging Het
Olfr610 A G 7: 103,506,457 V163A possibly damaging Het
Olfr74 A T 2: 87,974,170 V165E possibly damaging Het
Opn3 C T 1: 175,663,049 V349M probably damaging Het
Pank2 C A 2: 131,282,626 L297I probably damaging Het
Pcdh20 T A 14: 88,467,254 E870V probably benign Het
Phkb A T 8: 86,029,617 I847F probably damaging Het
Psmb1 A G 17: 15,477,247 F202S probably benign Het
Pwp2 C G 10: 78,184,293 probably null Het
Rbms3 A G 9: 117,251,741 Y21H probably damaging Het
Rhbdl1 T A 17: 25,836,184 K17* probably null Het
Rp1l1 C A 14: 64,028,218 Q418K possibly damaging Het
Slc22a4 A T 11: 54,007,789 V159E possibly damaging Het
Spata31d1a T C 13: 59,701,963 T784A possibly damaging Het
Tll1 A G 8: 64,098,510 M279T probably damaging Het
Tmem163 A T 1: 127,551,380 V134D probably damaging Het
Top2b A G 14: 16,409,958 N875S possibly damaging Het
Tpd52l1 T C 10: 31,332,857 E205G probably benign Het
Tpsb2 T A 17: 25,367,828 Y271* probably null Het
Ugt3a1 G A 15: 9,280,052 probably null Het
Vmn2r67 T C 7: 85,152,632 M154V probably benign Het
Zfp740 T G 15: 102,208,808 I89S probably benign Het
Other mutations in Pdcd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02573:Pdcd6 APN 13 74303979 missense probably damaging 1.00
IGL03029:Pdcd6 APN 13 74309780 missense probably damaging 1.00
R0379:Pdcd6 UTSW 13 74309712 missense possibly damaging 0.81
R0744:Pdcd6 UTSW 13 74316324 splice site probably benign
R0833:Pdcd6 UTSW 13 74316324 splice site probably benign
R1739:Pdcd6 UTSW 13 74304041 missense probably damaging 1.00
R1779:Pdcd6 UTSW 13 74305581 missense probably damaging 0.99
R1983:Pdcd6 UTSW 13 74304000 missense probably benign 0.05
R4665:Pdcd6 UTSW 13 74317206 start codon destroyed probably null 0.02
R5868:Pdcd6 UTSW 13 74304014 missense probably damaging 1.00
R6329:Pdcd6 UTSW 13 74303979 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCAAAACAAAGCTTGAGG -3'
(R):5'- GGCAGGGATAAGTAGGCTTTTA -3'

Sequencing Primer
(F):5'- GCTTGAGGGACTCCTATATTC -3'
(R):5'- CAGGGATAAGTAGGCTTTTAGGAATC -3'
Posted On2018-09-12