Incidental Mutation 'R6848:Mcidas'
ID534881
Institutional Source Beutler Lab
Gene Symbol Mcidas
Ensembl Gene ENSMUSG00000074651
Gene Namemulticiliate differentiation and DNA synthesis associated cell cycle protein
SynonymsIdas, Mci, multicilin, Mcin, Gm6320
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6848 (G1)
Quality Score193.009
Status Validated
Chromosome13
Chromosomal Location112993845-113000394 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 112993885 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 5 (E5G)
Ref Sequence ENSEMBL: ENSMUSP00000089721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038404] [ENSMUST00000092089]
Predicted Effect probably benign
Transcript: ENSMUST00000038404
SMART Domains Protein: ENSMUSP00000040083
Gene: ENSMUSG00000042417

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
low complexity region 30 46 N/A INTRINSIC
low complexity region 63 79 N/A INTRINSIC
CYCLIN 140 224 1.23e-19 SMART
Cyclin_C 233 350 3.49e-7 SMART
CYCLIN 244 327 5.77e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000092089
AA Change: E5G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000089721
Gene: ENSMUSG00000074651
AA Change: E5G

DomainStartEndE-ValueType
low complexity region 60 73 N/A INTRINSIC
Pfam:Geminin 169 258 4.8e-20 PFAM
low complexity region 262 272 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the geminin family of proteins. The encoded nuclear protein is required for the generation of multiciliated cells in respiratory epithelium. Mutations in this gene cause a rare mucociliary clearance disorder associated with recurring respiratory infections in human patients, known as reduced generation of multiple motile cilia (RGMC). [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap1 T C 11: 69,884,661 N290S probably damaging Het
Acox3 G T 5: 35,592,184 G218C probably damaging Het
Acsf3 G A 8: 122,790,590 G375D probably damaging Het
Adamts9 G T 6: 92,863,354 N568K possibly damaging Het
Akr1cl G A 1: 65,024,769 T87I probably damaging Het
Cacna1s G A 1: 136,092,694 R823Q probably benign Het
Casp16-ps A T 17: 23,551,079 C175* probably null Het
Cast T C 13: 74,695,933 K694R possibly damaging Het
Cep70 G A 9: 99,262,901 R100H probably benign Het
Cep72 C T 13: 74,038,276 A259T possibly damaging Het
Chsy1 T A 7: 66,171,037 M340K probably damaging Het
Col27a1 T C 4: 63,302,371 S182P probably benign Het
Crlf2 A C 5: 109,557,031 F103V possibly damaging Het
Dync2h1 T C 9: 7,159,632 N652S probably benign Het
Ephx4 G A 5: 107,426,918 G274D probably damaging Het
Fer T A 17: 63,991,606 F517I probably damaging Het
Fsip2 A T 2: 82,982,787 H3150L probably benign Het
Gata3 T A 2: 9,858,528 N392Y possibly damaging Het
Gm17660 A G 5: 104,074,737 probably benign Het
Gm5136 A T 10: 108,699,590 V168E probably damaging Het
Gria4 C T 9: 4,793,822 V79M probably damaging Het
Grk3 A C 5: 112,985,775 N60K probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Igf1r T G 7: 68,004,179 I155R probably damaging Het
Igsf9 T C 1: 172,495,762 L681P probably damaging Het
Intu T C 3: 40,694,255 M789T probably benign Het
Kit A T 5: 75,607,212 Q85L probably benign Het
Klhdc2 T A 12: 69,308,976 C325* probably null Het
Mcm5 G T 8: 75,127,290 R724L possibly damaging Het
Nrbp2 G A 15: 76,091,483 probably benign Het
Nrg1 A G 8: 31,818,056 I655T probably damaging Het
Nsun4 T C 4: 116,052,934 D143G possibly damaging Het
Olfr214 T C 6: 116,556,775 S117P probably damaging Het
Olfr610 A G 7: 103,506,457 V163A possibly damaging Het
Olfr74 A T 2: 87,974,170 V165E possibly damaging Het
Opn3 C T 1: 175,663,049 V349M probably damaging Het
Pank2 C A 2: 131,282,626 L297I probably damaging Het
Pcdh20 T A 14: 88,467,254 E870V probably benign Het
Pdcd6 T A 13: 74,309,840 M71L possibly damaging Het
Phkb A T 8: 86,029,617 I847F probably damaging Het
Psmb1 A G 17: 15,477,247 F202S probably benign Het
Pwp2 C G 10: 78,184,293 probably null Het
Rbms3 A G 9: 117,251,741 Y21H probably damaging Het
Rhbdl1 T A 17: 25,836,184 K17* probably null Het
Rp1l1 C A 14: 64,028,218 Q418K possibly damaging Het
Slc22a4 A T 11: 54,007,789 V159E possibly damaging Het
Spata31d1a T C 13: 59,701,963 T784A possibly damaging Het
Tll1 A G 8: 64,098,510 M279T probably damaging Het
Tmem163 A T 1: 127,551,380 V134D probably damaging Het
Top2b A G 14: 16,409,958 N875S possibly damaging Het
Tpd52l1 T C 10: 31,332,857 E205G probably benign Het
Tpsb2 T A 17: 25,367,828 Y271* probably null Het
Ugt3a1 G A 15: 9,280,052 probably null Het
Vmn2r67 T C 7: 85,152,632 M154V probably benign Het
Zfp740 T G 15: 102,208,808 I89S probably benign Het
Other mutations in Mcidas
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Mcidas APN 13 112997585 splice site probably benign
IGL01355:Mcidas APN 13 112999069 missense probably damaging 1.00
IGL02000:Mcidas APN 13 112997440 missense probably benign
IGL02019:Mcidas APN 13 112996843 missense probably benign 0.00
R0145:Mcidas UTSW 13 112994372 missense probably damaging 1.00
R0412:Mcidas UTSW 13 112999143 missense probably damaging 1.00
R1293:Mcidas UTSW 13 112997392 missense probably benign
R2011:Mcidas UTSW 13 112993981 missense possibly damaging 0.84
R4183:Mcidas UTSW 13 112994372 missense probably damaging 1.00
R4905:Mcidas UTSW 13 112994417 missense possibly damaging 0.84
R4905:Mcidas UTSW 13 112997504 missense possibly damaging 0.82
R5615:Mcidas UTSW 13 112997425 missense probably benign 0.01
R5997:Mcidas UTSW 13 112998586 missense probably damaging 0.99
R7387:Mcidas UTSW 13 112994088 missense probably benign 0.03
R7398:Mcidas UTSW 13 112996882 missense probably benign
R7742:Mcidas UTSW 13 112998987 missense probably damaging 1.00
R7795:Mcidas UTSW 13 112998987 missense probably damaging 1.00
R7797:Mcidas UTSW 13 112998987 missense probably damaging 1.00
R7872:Mcidas UTSW 13 112998987 missense probably damaging 1.00
R7873:Mcidas UTSW 13 112998987 missense probably damaging 1.00
R7955:Mcidas UTSW 13 112998987 missense probably damaging 1.00
R7956:Mcidas UTSW 13 112998987 missense probably damaging 1.00
X0066:Mcidas UTSW 13 112997447 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TTGCCAGGTTGGTTAACGCC -3'
(R):5'- TCCACGAAGGAACGAACTG -3'

Sequencing Primer
(F):5'- GTTGGTTAACGCCTCCGC -3'
(R):5'- GGATGCACATGGTCAGCGTTC -3'
Posted On2018-09-12