Incidental Mutation 'R6848:Pcdh20'
ID534884
Institutional Source Beutler Lab
Gene Symbol Pcdh20
Ensembl Gene ENSMUSG00000050505
Gene Nameprotocadherin 20
SynonymsC630015B17Rik, PCDH13
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6848 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location88464743-88471396 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 88467254 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 870 (E870V)
Ref Sequence ENSEMBL: ENSMUSP00000141860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061628] [ENSMUST00000192557]
Predicted Effect probably benign
Transcript: ENSMUST00000061628
AA Change: E870V

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000054774
Gene: ENSMUSG00000050505
AA Change: E870V

DomainStartEndE-ValueType
CA 108 208 9.02e-1 SMART
CA 233 319 6.63e-16 SMART
CA 343 425 9.94e-2 SMART
CA 455 534 7.48e-3 SMART
CA 558 638 5.46e-26 SMART
CA 662 741 7.2e-26 SMART
CA 768 852 9.6e-13 SMART
low complexity region 860 871 N/A INTRINSIC
transmembrane domain 890 912 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192557
AA Change: E870V

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000141860
Gene: ENSMUSG00000050505
AA Change: E870V

DomainStartEndE-ValueType
CA 108 208 9.02e-1 SMART
CA 233 319 6.63e-16 SMART
CA 343 425 9.94e-2 SMART
CA 455 534 7.48e-3 SMART
CA 558 638 5.46e-26 SMART
CA 662 741 7.2e-26 SMART
CA 768 852 9.6e-13 SMART
low complexity region 860 871 N/A INTRINSIC
transmembrane domain 890 912 N/A INTRINSIC
Meta Mutation Damage Score 0.0685 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. The encoded protein contains six extracellular cadherin domains, a transmembrane domain, and a cytoplasmic tail differing from those of the classical cadherins. The encoded protein may play a role in cell adhesion in the nervous system and has been shown to be specifically expressed in newly differentiated olfactory sensory neurons and their axons during development. In adult mice, the expression of this protein in the olfactory system is more restricted but shows a gender difference with higher expression in the male than in the female. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap1 T C 11: 69,884,661 N290S probably damaging Het
Acox3 G T 5: 35,592,184 G218C probably damaging Het
Acsf3 G A 8: 122,790,590 G375D probably damaging Het
Adamts9 G T 6: 92,863,354 N568K possibly damaging Het
Akr1cl G A 1: 65,024,769 T87I probably damaging Het
Cacna1s G A 1: 136,092,694 R823Q probably benign Het
Casp16-ps A T 17: 23,551,079 C175* probably null Het
Cast T C 13: 74,695,933 K694R possibly damaging Het
Cep70 G A 9: 99,262,901 R100H probably benign Het
Cep72 C T 13: 74,038,276 A259T possibly damaging Het
Chsy1 T A 7: 66,171,037 M340K probably damaging Het
Col27a1 T C 4: 63,302,371 S182P probably benign Het
Crlf2 A C 5: 109,557,031 F103V possibly damaging Het
Dync2h1 T C 9: 7,159,632 N652S probably benign Het
Ephx4 G A 5: 107,426,918 G274D probably damaging Het
Fer T A 17: 63,991,606 F517I probably damaging Het
Fsip2 A T 2: 82,982,787 H3150L probably benign Het
Gata3 T A 2: 9,858,528 N392Y possibly damaging Het
Gm17660 A G 5: 104,074,737 probably benign Het
Gm5136 A T 10: 108,699,590 V168E probably damaging Het
Gria4 C T 9: 4,793,822 V79M probably damaging Het
Grk3 A C 5: 112,985,775 N60K probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Igf1r T G 7: 68,004,179 I155R probably damaging Het
Igsf9 T C 1: 172,495,762 L681P probably damaging Het
Intu T C 3: 40,694,255 M789T probably benign Het
Kit A T 5: 75,607,212 Q85L probably benign Het
Klhdc2 T A 12: 69,308,976 C325* probably null Het
Mcidas A G 13: 112,993,885 E5G probably benign Het
Mcm5 G T 8: 75,127,290 R724L possibly damaging Het
Nrbp2 G A 15: 76,091,483 probably benign Het
Nrg1 A G 8: 31,818,056 I655T probably damaging Het
Nsun4 T C 4: 116,052,934 D143G possibly damaging Het
Olfr214 T C 6: 116,556,775 S117P probably damaging Het
Olfr610 A G 7: 103,506,457 V163A possibly damaging Het
Olfr74 A T 2: 87,974,170 V165E possibly damaging Het
Opn3 C T 1: 175,663,049 V349M probably damaging Het
Pank2 C A 2: 131,282,626 L297I probably damaging Het
Pdcd6 T A 13: 74,309,840 M71L possibly damaging Het
Phkb A T 8: 86,029,617 I847F probably damaging Het
Psmb1 A G 17: 15,477,247 F202S probably benign Het
Pwp2 C G 10: 78,184,293 probably null Het
Rbms3 A G 9: 117,251,741 Y21H probably damaging Het
Rhbdl1 T A 17: 25,836,184 K17* probably null Het
Rp1l1 C A 14: 64,028,218 Q418K possibly damaging Het
Slc22a4 A T 11: 54,007,789 V159E possibly damaging Het
Spata31d1a T C 13: 59,701,963 T784A possibly damaging Het
Tll1 A G 8: 64,098,510 M279T probably damaging Het
Tmem163 A T 1: 127,551,380 V134D probably damaging Het
Top2b A G 14: 16,409,958 N875S possibly damaging Het
Tpd52l1 T C 10: 31,332,857 E205G probably benign Het
Tpsb2 T A 17: 25,367,828 Y271* probably null Het
Ugt3a1 G A 15: 9,280,052 probably null Het
Vmn2r67 T C 7: 85,152,632 M154V probably benign Het
Zfp740 T G 15: 102,208,808 I89S probably benign Het
Other mutations in Pcdh20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Pcdh20 APN 14 88467881 missense possibly damaging 0.65
IGL01112:Pcdh20 APN 14 88467200 missense probably benign 0.01
IGL01586:Pcdh20 APN 14 88470908 missense probably benign 0.37
IGL02007:Pcdh20 APN 14 88469595 missense probably benign 0.09
IGL02545:Pcdh20 APN 14 88468844 missense possibly damaging 0.74
IGL02935:Pcdh20 APN 14 88467002 utr 3 prime probably benign
PIT4362001:Pcdh20 UTSW 14 88467026 missense probably damaging 0.97
PIT4403001:Pcdh20 UTSW 14 88467026 missense probably damaging 0.97
PIT4453001:Pcdh20 UTSW 14 88467308 missense probably damaging 1.00
R0322:Pcdh20 UTSW 14 88468947 missense probably benign 0.24
R0372:Pcdh20 UTSW 14 88469003 missense probably damaging 1.00
R0391:Pcdh20 UTSW 14 88468668 missense probably benign
R0575:Pcdh20 UTSW 14 88467612 missense probably damaging 1.00
R0789:Pcdh20 UTSW 14 88468790 missense probably damaging 1.00
R1370:Pcdh20 UTSW 14 88468301 missense probably benign 0.00
R1465:Pcdh20 UTSW 14 88469237 missense probably benign 0.00
R1465:Pcdh20 UTSW 14 88469237 missense probably benign 0.00
R1664:Pcdh20 UTSW 14 88468322 missense possibly damaging 0.63
R1677:Pcdh20 UTSW 14 88467974 missense probably damaging 1.00
R1764:Pcdh20 UTSW 14 88469184 missense possibly damaging 0.77
R1907:Pcdh20 UTSW 14 88468704 missense probably benign 0.01
R2043:Pcdh20 UTSW 14 88467155 missense probably benign 0.01
R2430:Pcdh20 UTSW 14 88467548 missense probably damaging 1.00
R2471:Pcdh20 UTSW 14 88467236 missense probably benign 0.00
R3838:Pcdh20 UTSW 14 88468463 missense probably benign 0.00
R4163:Pcdh20 UTSW 14 88468179 missense probably damaging 1.00
R4472:Pcdh20 UTSW 14 88468998 missense probably benign 0.21
R4602:Pcdh20 UTSW 14 88468430 missense probably damaging 1.00
R4681:Pcdh20 UTSW 14 88467616 missense probably damaging 1.00
R4918:Pcdh20 UTSW 14 88467668 missense probably damaging 1.00
R4921:Pcdh20 UTSW 14 88469726 missense probably benign 0.01
R5204:Pcdh20 UTSW 14 88468915 missense probably damaging 1.00
R5256:Pcdh20 UTSW 14 88468377 missense probably benign
R5652:Pcdh20 UTSW 14 88467324 missense probably damaging 1.00
R5815:Pcdh20 UTSW 14 88470876 missense probably benign 0.03
R6195:Pcdh20 UTSW 14 88468052 missense probably benign 0.39
R6233:Pcdh20 UTSW 14 88468052 missense probably benign 0.39
R6913:Pcdh20 UTSW 14 88468602 missense probably benign
R7044:Pcdh20 UTSW 14 88469171 missense probably damaging 0.98
R7224:Pcdh20 UTSW 14 88469075 missense possibly damaging 0.85
R7388:Pcdh20 UTSW 14 88468667 missense probably benign 0.33
R7486:Pcdh20 UTSW 14 88468614 missense possibly damaging 0.79
R7651:Pcdh20 UTSW 14 88469153 missense probably damaging 1.00
R7664:Pcdh20 UTSW 14 88469367 missense probably benign
R7706:Pcdh20 UTSW 14 88467357 missense probably damaging 1.00
R7832:Pcdh20 UTSW 14 88469707 missense probably null 0.02
R7892:Pcdh20 UTSW 14 88467431 nonsense probably null
R7915:Pcdh20 UTSW 14 88469707 missense probably null 0.02
R7975:Pcdh20 UTSW 14 88467431 nonsense probably null
X0028:Pcdh20 UTSW 14 88467617 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGTTACAATGTCCCTCCATG -3'
(R):5'- CAGACAGATTATGGGTTGCATCG -3'

Sequencing Primer
(F):5'- CCATGTTATTCCACAATGGCATATC -3'
(R):5'- GCATCGCTTACTGGTGAAAG -3'
Posted On2018-09-12