Incidental Mutation 'R6848:Rhbdl1'
ID534891
Institutional Source Beutler Lab
Gene Symbol Rhbdl1
Ensembl Gene ENSMUSG00000025735
Gene Namerhomboid like 1
SynonymsRhbdl
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6848 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location25834465-25837295 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 25836184 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 17 (K17*)
Ref Sequence ENSEMBL: ENSMUSP00000138927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026831] [ENSMUST00000026832] [ENSMUST00000043897] [ENSMUST00000044911] [ENSMUST00000133595] [ENSMUST00000183929] [ENSMUST00000184865]
Predicted Effect probably null
Transcript: ENSMUST00000026831
AA Change: K71*
SMART Domains Protein: ENSMUSP00000026831
Gene: ENSMUSG00000025735
AA Change: K71*

DomainStartEndE-ValueType
SCOP:d2mysb_ 13 74 5e-7 SMART
Blast:EFh 43 71 9e-11 BLAST
transmembrane domain 129 151 N/A INTRINSIC
Pfam:Rhomboid 174 331 6.7e-36 PFAM
transmembrane domain 339 361 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000026832
SMART Domains Protein: ENSMUSP00000026832
Gene: ENSMUSG00000025736

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
JmjC 140 271 5.27e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000043897
SMART Domains Protein: ENSMUSP00000044639
Gene: ENSMUSG00000025733

DomainStartEndE-ValueType
Pfam:Roc 6 122 4.1e-11 PFAM
Pfam:Ras 6 168 2.3e-18 PFAM
EFh 188 216 1.27e1 SMART
Pfam:EF_assoc_2 219 305 2.2e-35 PFAM
EFh 308 336 1.23e-1 SMART
Pfam:EF_assoc_1 341 412 1.8e-25 PFAM
Blast:AAA 416 547 7e-18 BLAST
SCOP:d1mh1__ 422 532 4e-8 SMART
transmembrane domain 595 617 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000044911
SMART Domains Protein: ENSMUSP00000040431
Gene: ENSMUSG00000039615

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
TPR 27 60 2.43e1 SMART
TPR 61 94 1.48e-7 SMART
TPR 95 128 4.52e-3 SMART
low complexity region 168 180 N/A INTRINSIC
Ubox 231 294 1.27e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133595
SMART Domains Protein: ENSMUSP00000122744
Gene: ENSMUSG00000025736

DomainStartEndE-ValueType
transmembrane domain 55 74 N/A INTRINSIC
JmjC 185 316 5.27e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176751
Predicted Effect probably null
Transcript: ENSMUST00000183929
AA Change: K75*
SMART Domains Protein: ENSMUSP00000139046
Gene: ENSMUSG00000025735
AA Change: K75*

DomainStartEndE-ValueType
SCOP:d2mysb_ 13 74 9e-6 SMART
Blast:EFh 43 70 2e-9 BLAST
transmembrane domain 136 155 N/A INTRINSIC
Pfam:Rhomboid 178 327 1e-27 PFAM
transmembrane domain 335 357 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000184865
AA Change: K17*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein similar to Rhomboid in Drosophila which is involved in signalling in the Spitz/epidermal growth factor receptor/mitogen-activated protein kinase pathway. The Rhomboid family of proteins consists of intramembrane serine proteases containing several transmembrane domains. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap1 T C 11: 69,884,661 N290S probably damaging Het
Acox3 G T 5: 35,592,184 G218C probably damaging Het
Acsf3 G A 8: 122,790,590 G375D probably damaging Het
Adamts9 G T 6: 92,863,354 N568K possibly damaging Het
Akr1cl G A 1: 65,024,769 T87I probably damaging Het
Cacna1s G A 1: 136,092,694 R823Q probably benign Het
Casp16-ps A T 17: 23,551,079 C175* probably null Het
Cast T C 13: 74,695,933 K694R possibly damaging Het
Cep70 G A 9: 99,262,901 R100H probably benign Het
Cep72 C T 13: 74,038,276 A259T possibly damaging Het
Chsy1 T A 7: 66,171,037 M340K probably damaging Het
Col27a1 T C 4: 63,302,371 S182P probably benign Het
Crlf2 A C 5: 109,557,031 F103V possibly damaging Het
Dync2h1 T C 9: 7,159,632 N652S probably benign Het
Ephx4 G A 5: 107,426,918 G274D probably damaging Het
Fer T A 17: 63,991,606 F517I probably damaging Het
Fsip2 A T 2: 82,982,787 H3150L probably benign Het
Gata3 T A 2: 9,858,528 N392Y possibly damaging Het
Gm17660 A G 5: 104,074,737 probably benign Het
Gm5136 A T 10: 108,699,590 V168E probably damaging Het
Gria4 C T 9: 4,793,822 V79M probably damaging Het
Grk3 A C 5: 112,985,775 N60K probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Igf1r T G 7: 68,004,179 I155R probably damaging Het
Igsf9 T C 1: 172,495,762 L681P probably damaging Het
Intu T C 3: 40,694,255 M789T probably benign Het
Kit A T 5: 75,607,212 Q85L probably benign Het
Klhdc2 T A 12: 69,308,976 C325* probably null Het
Mcidas A G 13: 112,993,885 E5G probably benign Het
Mcm5 G T 8: 75,127,290 R724L possibly damaging Het
Nrbp2 G A 15: 76,091,483 probably benign Het
Nrg1 A G 8: 31,818,056 I655T probably damaging Het
Nsun4 T C 4: 116,052,934 D143G possibly damaging Het
Olfr214 T C 6: 116,556,775 S117P probably damaging Het
Olfr610 A G 7: 103,506,457 V163A possibly damaging Het
Olfr74 A T 2: 87,974,170 V165E possibly damaging Het
Opn3 C T 1: 175,663,049 V349M probably damaging Het
Pank2 C A 2: 131,282,626 L297I probably damaging Het
Pcdh20 T A 14: 88,467,254 E870V probably benign Het
Pdcd6 T A 13: 74,309,840 M71L possibly damaging Het
Phkb A T 8: 86,029,617 I847F probably damaging Het
Psmb1 A G 17: 15,477,247 F202S probably benign Het
Pwp2 C G 10: 78,184,293 probably null Het
Rbms3 A G 9: 117,251,741 Y21H probably damaging Het
Rp1l1 C A 14: 64,028,218 Q418K possibly damaging Het
Slc22a4 A T 11: 54,007,789 V159E possibly damaging Het
Spata31d1a T C 13: 59,701,963 T784A possibly damaging Het
Tll1 A G 8: 64,098,510 M279T probably damaging Het
Tmem163 A T 1: 127,551,380 V134D probably damaging Het
Top2b A G 14: 16,409,958 N875S possibly damaging Het
Tpd52l1 T C 10: 31,332,857 E205G probably benign Het
Tpsb2 T A 17: 25,367,828 Y271* probably null Het
Ugt3a1 G A 15: 9,280,052 probably null Het
Vmn2r67 T C 7: 85,152,632 M154V probably benign Het
Zfp740 T G 15: 102,208,808 I89S probably benign Het
Other mutations in Rhbdl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01575:Rhbdl1 APN 17 25836138 missense possibly damaging 0.62
R1672:Rhbdl1 UTSW 17 25836409 critical splice donor site probably null
R1922:Rhbdl1 UTSW 17 25835539 missense probably damaging 1.00
R4976:Rhbdl1 UTSW 17 25835028 nonsense probably null
R5500:Rhbdl1 UTSW 17 25836554 missense possibly damaging 0.83
R6293:Rhbdl1 UTSW 17 25834969 missense probably damaging 1.00
R6296:Rhbdl1 UTSW 17 25834969 missense probably damaging 1.00
R6535:Rhbdl1 UTSW 17 25835825 nonsense probably null
R7619:Rhbdl1 UTSW 17 25837017 missense possibly damaging 0.85
R7721:Rhbdl1 UTSW 17 25836149 missense probably benign 0.10
R7746:Rhbdl1 UTSW 17 25836193 missense probably benign 0.06
R8015:Rhbdl1 UTSW 17 25835851 missense probably damaging 1.00
X0009:Rhbdl1 UTSW 17 25836409 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCCTGTAGAAGTACCAGCG -3'
(R):5'- ACCAAGTTGGACATGTTGGTG -3'

Sequencing Primer
(F):5'- TAGAAGTACCAGCGGCGGTC -3'
(R):5'- TGGACCTGGTCAGTGCCATG -3'
Posted On2018-09-12