Incidental Mutation 'R6849:Slc45a3'
ID534894
Institutional Source Beutler Lab
Gene Symbol Slc45a3
Ensembl Gene ENSMUSG00000026435
Gene Namesolute carrier family 45, member 3
Synonyms2210413P12Rik, Pcanap6, IPCA-6
MMRRC Submission
Accession Numbers

Genbank: NM_145977; MGI: 1922082  

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6849 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location131962967-131982969 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 131977964 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 242 (C242S)
Ref Sequence ENSEMBL: ENSMUSP00000136190 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027695] [ENSMUST00000177943] [ENSMUST00000190322]
Predicted Effect probably damaging
Transcript: ENSMUST00000027695
AA Change: C242S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027695
Gene: ENSMUSG00000026435
AA Change: C242S

DomainStartEndE-ValueType
Pfam:MFS_1 18 306 1.2e-12 PFAM
Pfam:MFS_2 21 408 5.4e-11 PFAM
transmembrane domain 520 542 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177943
AA Change: C242S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136190
Gene: ENSMUSG00000026435
AA Change: C242S

DomainStartEndE-ValueType
Pfam:MFS_1 18 306 1.5e-12 PFAM
Pfam:MFS_2 19 239 2.4e-13 PFAM
transmembrane domain 320 342 N/A INTRINSIC
transmembrane domain 355 377 N/A INTRINSIC
transmembrane domain 382 404 N/A INTRINSIC
transmembrane domain 520 542 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190322
SMART Domains Protein: ENSMUSP00000140767
Gene: ENSMUSG00000026435

DomainStartEndE-ValueType
Pfam:MFS_2 20 218 3.3e-9 PFAM
Pfam:MFS_1 51 219 1.7e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik G T 8: 124,639,522 Q161K probably damaging Het
4930578I06Rik A T 14: 63,986,238 W30R probably damaging Het
4930578I06Rik G T 14: 63,986,239 N29K probably benign Het
Aldh6a1 A G 12: 84,443,787 V18A probably benign Het
Apoa5 A G 9: 46,270,000 K125E probably benign Het
Bphl T A 13: 34,050,269 probably null Het
C2cd3 T A 7: 100,406,927 V514E probably damaging Het
C530008M17Rik C A 5: 76,857,010 A406E unknown Het
C530008M17Rik C T 5: 76,857,157 A455V unknown Het
Cacna1s G A 1: 136,092,694 R823Q probably benign Het
Cep192 A G 18: 67,812,435 D202G probably benign Het
Chd5 A T 4: 152,378,538 N1420Y probably damaging Het
Cnot10 A T 9: 114,631,936 D55E probably benign Het
Cntn1 T A 15: 92,305,246 I803N probably damaging Het
Col7a1 G T 9: 108,975,053 V2217L unknown Het
Cpne9 T G 6: 113,302,118 V491G probably damaging Het
Csnk2a1 C A 2: 152,250,564 H18Q probably benign Het
D130040H23Rik T A 8: 69,302,651 Y253* probably null Het
Dnah14 A T 1: 181,808,945 M4321L probably benign Het
Dnah5 A G 15: 28,278,624 T1122A probably benign Het
Eif4g1 A G 16: 20,680,745 I515V probably benign Het
Fam214a A C 9: 75,009,312 N398H probably damaging Het
Fbn1 T C 2: 125,321,691 K2082E possibly damaging Het
Fstl1 A G 16: 37,821,159 K99R probably benign Het
Gar1 T C 3: 129,829,389 N117S probably damaging Het
Gm3238 A T 10: 77,770,910 probably benign Het
Gm32742 C T 9: 51,138,714 M1528I probably benign Het
H2-T3 T C 17: 36,189,805 I49V probably benign Het
Hyou1 A G 9: 44,387,264 I581V probably damaging Het
Itk T C 11: 46,331,935 N563S probably damaging Het
Lingo1 A G 9: 56,619,616 L563P probably damaging Het
Lipc A G 9: 70,818,847 probably null Het
Map4k3 A C 17: 80,630,413 probably null Het
Mctp2 C T 7: 72,211,718 C393Y probably damaging Het
Mei1 T A 15: 82,079,945 L229M possibly damaging Het
Olfr1501 G T 19: 13,838,839 C111* probably null Het
Olfr309 T C 7: 86,307,040 I24M possibly damaging Het
Pcnx2 A G 8: 125,861,210 V833A probably damaging Het
Pde8b T C 13: 95,047,799 N388D possibly damaging Het
Pi4ka G A 16: 17,303,421 A1197V possibly damaging Het
Psd A G 19: 46,317,746 Y36H probably damaging Het
Scn8a T A 15: 100,955,587 probably null Het
Shisa6 A G 11: 66,525,501 V155A probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Tmc3 T A 7: 83,586,357 I54K probably damaging Het
Tmprss11g T A 5: 86,496,632 I118F probably benign Het
Ttn T A 2: 76,914,343 D5454V possibly damaging Het
Ube2f A G 1: 91,254,213 probably null Het
Ubr7 T C 12: 102,758,083 S19P probably damaging Het
Vav3 T C 3: 109,521,466 V371A probably damaging Het
Vmn2r28 A G 7: 5,480,807 V798A probably damaging Het
Vmn2r95 T G 17: 18,443,919 C467G probably damaging Het
Vmn2r95 G T 17: 18,443,920 C467F probably damaging Het
Vps13b A G 15: 35,905,309 D3325G probably damaging Het
Wnk2 T C 13: 49,067,358 T1158A probably damaging Het
Zfp616 T A 11: 74,085,450 N848K possibly damaging Het
Other mutations in Slc45a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00962:Slc45a3 APN 1 131977527 missense probably damaging 0.98
IGL01626:Slc45a3 APN 1 131978987 missense possibly damaging 0.73
IGL01677:Slc45a3 APN 1 131978970 missense probably damaging 0.99
F6893:Slc45a3 UTSW 1 131981337 missense probably benign
R0122:Slc45a3 UTSW 1 131977740 missense probably damaging 1.00
R0402:Slc45a3 UTSW 1 131977527 missense possibly damaging 0.85
R1596:Slc45a3 UTSW 1 131981529 missense probably damaging 1.00
R1647:Slc45a3 UTSW 1 131977524 missense probably damaging 1.00
R1752:Slc45a3 UTSW 1 131977521 missense probably damaging 1.00
R1771:Slc45a3 UTSW 1 131976956 missense possibly damaging 0.51
R1776:Slc45a3 UTSW 1 131976956 missense possibly damaging 0.51
R2071:Slc45a3 UTSW 1 131977632 missense probably damaging 1.00
R2939:Slc45a3 UTSW 1 131977899 missense probably damaging 1.00
R4230:Slc45a3 UTSW 1 131981661 missense probably damaging 0.96
R4876:Slc45a3 UTSW 1 131981547 missense possibly damaging 0.48
R4906:Slc45a3 UTSW 1 131981577 missense probably damaging 1.00
R5265:Slc45a3 UTSW 1 131978194 missense possibly damaging 0.46
R5964:Slc45a3 UTSW 1 131978073 missense probably damaging 0.98
R7483:Slc45a3 UTSW 1 131976811 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CTTACCTGCCATTGACTGGGAC -3'
(R):5'- CTTCATCATAGTGTCTCCGGG -3'

Sequencing Primer
(F):5'- TGGGACACCAGCGTTCTG -3'
(R):5'- ATAGTGTCTCCGGGCCTCG -3'
Posted On2018-09-12