Incidental Mutation 'R6849:Tmprss11g'
ID534905
Institutional Source Beutler Lab
Gene Symbol Tmprss11g
Ensembl Gene ENSMUSG00000079451
Gene Nametransmembrane protease, serine 11g
SynonymsDesc4, 9930032O22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R6849 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location86485876-86518600 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86496632 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 118 (I118F)
Ref Sequence ENSEMBL: ENSMUSP00000115540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000134179] [ENSMUST00000140095]
Predicted Effect probably benign
Transcript: ENSMUST00000134179
AA Change: I118F

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000122709
Gene: ENSMUSG00000079451
AA Change: I118F

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:SEA 48 150 1.5e-25 PFAM
Tryp_SPc 185 411 1.39e-82 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140095
AA Change: I118F

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000115540
Gene: ENSMUSG00000079451
AA Change: I118F

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:SEA 45 154 1.3e-19 PFAM
Tryp_SPc 172 398 1.39e-82 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik G T 8: 124,639,522 Q161K probably damaging Het
4930578I06Rik A T 14: 63,986,238 W30R probably damaging Het
4930578I06Rik G T 14: 63,986,239 N29K probably benign Het
Aldh6a1 A G 12: 84,443,787 V18A probably benign Het
Apoa5 A G 9: 46,270,000 K125E probably benign Het
Bphl T A 13: 34,050,269 probably null Het
C2cd3 T A 7: 100,406,927 V514E probably damaging Het
C530008M17Rik C A 5: 76,857,010 A406E unknown Het
C530008M17Rik C T 5: 76,857,157 A455V unknown Het
Cacna1s G A 1: 136,092,694 R823Q probably benign Het
Cep192 A G 18: 67,812,435 D202G probably benign Het
Chd5 A T 4: 152,378,538 N1420Y probably damaging Het
Cnot10 A T 9: 114,631,936 D55E probably benign Het
Cntn1 T A 15: 92,305,246 I803N probably damaging Het
Col7a1 G T 9: 108,975,053 V2217L unknown Het
Cpne9 T G 6: 113,302,118 V491G probably damaging Het
Csnk2a1 C A 2: 152,250,564 H18Q probably benign Het
D130040H23Rik T A 8: 69,302,651 Y253* probably null Het
Dnah14 A T 1: 181,808,945 M4321L probably benign Het
Dnah5 A G 15: 28,278,624 T1122A probably benign Het
Eif4g1 A G 16: 20,680,745 I515V probably benign Het
Fam214a A C 9: 75,009,312 N398H probably damaging Het
Fbn1 T C 2: 125,321,691 K2082E possibly damaging Het
Fstl1 A G 16: 37,821,159 K99R probably benign Het
Gar1 T C 3: 129,829,389 N117S probably damaging Het
Gm3238 A T 10: 77,770,910 probably benign Het
Gm32742 C T 9: 51,138,714 M1528I probably benign Het
H2-T3 T C 17: 36,189,805 I49V probably benign Het
Hyou1 A G 9: 44,387,264 I581V probably damaging Het
Itk T C 11: 46,331,935 N563S probably damaging Het
Lingo1 A G 9: 56,619,616 L563P probably damaging Het
Lipc A G 9: 70,818,847 probably null Het
Map4k3 A C 17: 80,630,413 probably null Het
Mctp2 C T 7: 72,211,718 C393Y probably damaging Het
Mei1 T A 15: 82,079,945 L229M possibly damaging Het
Olfr1501 G T 19: 13,838,839 C111* probably null Het
Olfr309 T C 7: 86,307,040 I24M possibly damaging Het
Pcnx2 A G 8: 125,861,210 V833A probably damaging Het
Pde8b T C 13: 95,047,799 N388D possibly damaging Het
Pi4ka G A 16: 17,303,421 A1197V possibly damaging Het
Psd A G 19: 46,317,746 Y36H probably damaging Het
Scn8a T A 15: 100,955,587 probably null Het
Shisa6 A G 11: 66,525,501 V155A probably benign Het
Slc45a3 T A 1: 131,977,964 C242S probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Tmc3 T A 7: 83,586,357 I54K probably damaging Het
Ttn T A 2: 76,914,343 D5454V possibly damaging Het
Ube2f A G 1: 91,254,213 probably null Het
Ubr7 T C 12: 102,758,083 S19P probably damaging Het
Vav3 T C 3: 109,521,466 V371A probably damaging Het
Vmn2r28 A G 7: 5,480,807 V798A probably damaging Het
Vmn2r95 T G 17: 18,443,919 C467G probably damaging Het
Vmn2r95 G T 17: 18,443,920 C467F probably damaging Het
Vps13b A G 15: 35,905,309 D3325G probably damaging Het
Wnk2 T C 13: 49,067,358 T1158A probably damaging Het
Zfp616 T A 11: 74,085,450 N848K possibly damaging Het
Other mutations in Tmprss11g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Tmprss11g APN 5 86492191 missense probably benign 0.00
IGL01611:Tmprss11g APN 5 86490781 missense probably benign 0.02
IGL02417:Tmprss11g APN 5 86490891 missense probably benign 0.25
IGL02677:Tmprss11g APN 5 86492290 missense probably benign
IGL02832:Tmprss11g APN 5 86497269 missense probably benign 0.23
IGL02887:Tmprss11g APN 5 86497329 splice site probably benign
R0377:Tmprss11g UTSW 5 86490751 missense probably damaging 0.98
R0847:Tmprss11g UTSW 5 86490726 missense probably benign 0.01
R1037:Tmprss11g UTSW 5 86490747 missense probably damaging 1.00
R1507:Tmprss11g UTSW 5 86499611 missense probably benign 0.09
R1617:Tmprss11g UTSW 5 86499563 missense probably damaging 0.99
R1955:Tmprss11g UTSW 5 86498532 missense probably damaging 0.99
R2094:Tmprss11g UTSW 5 86499556 missense probably damaging 1.00
R2906:Tmprss11g UTSW 5 86492802 intron probably benign
R4730:Tmprss11g UTSW 5 86489232 nonsense probably null
R4730:Tmprss11g UTSW 5 86489233 missense probably damaging 1.00
R4934:Tmprss11g UTSW 5 86496542 missense probably benign
R4982:Tmprss11g UTSW 5 86492815 missense probably damaging 1.00
R5086:Tmprss11g UTSW 5 86496518 missense possibly damaging 0.65
R5606:Tmprss11g UTSW 5 86487410 missense probably damaging 1.00
R5825:Tmprss11g UTSW 5 86498533 missense probably damaging 0.98
R6291:Tmprss11g UTSW 5 86487422 missense probably damaging 1.00
R6481:Tmprss11g UTSW 5 86492156 missense probably benign 0.20
R6925:Tmprss11g UTSW 5 86487426 missense probably benign 0.09
R6925:Tmprss11g UTSW 5 86487436 missense probably benign 0.00
R7084:Tmprss11g UTSW 5 86492200 missense probably damaging 1.00
R7089:Tmprss11g UTSW 5 86489291 missense probably damaging 0.97
R7190:Tmprss11g UTSW 5 86496632 missense probably benign 0.18
R7352:Tmprss11g UTSW 5 86496542 missense not run
R7432:Tmprss11g UTSW 5 86496507 missense possibly damaging 0.71
R7514:Tmprss11g UTSW 5 86497317 missense probably damaging 1.00
R8198:Tmprss11g UTSW 5 86498493 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAAAGAGCTTTCTCCATAGACAGAAGG -3'
(R):5'- ATCTAGGAGTTAACATCTGTGTGAC -3'

Sequencing Primer
(F):5'- TCCATAGACAGAAGGTTGTTAAAAAG -3'
(R):5'- CTGTGTGACATATAAATGGGAAGCTC -3'
Posted On2018-09-12