Mutagenetix > Incidental Mutation

Incidental Mutation 'R6849:Mctp2'

534908

Institutional Source

Beutler Lab

Gene Symbol

Mctp2

Ensembl Gene

ENSMUSG00000032776

Gene Name

multiple C2 domains, transmembrane 2

Synonyms

LOC244049

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.123) question?

Stock #

R6849 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

72077830-72306608 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 72211718 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Tyrosine at position 393 (C393Y)

Ref Sequence

ENSEMBL: ENSMUSP00000078302 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079323]

AlphaFold

Q5RJH2

Predicted Effect

probably damaging
Transcript: ENSMUST00000079323
AA Change: C393Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000078302
Gene: ENSMUSG00000032776
AA Change: C393Y

Domain	Start	End	E-Value	Type
low complexity region	24	35	N/A	INTRINSIC
low complexity region	90	103	N/A	INTRINSIC
C2	195	291	7.5e-20	SMART
C2	357	451	1.27e-8	SMART
C2	510	606	5.38e-21	SMART
transmembrane domain	696	718	N/A	INTRINSIC
Pfam:PRT_C	723	857	2.4e-11	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

100% (55/55)

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310022B05Rik	G	T	8: 124,639,522	Q161K	probably damaging	Het
4930578I06Rik	A	T	14: 63,986,238	W30R	probably damaging	Het
4930578I06Rik	G	T	14: 63,986,239	N29K	probably benign	Het
Aldh6a1	A	G	12: 84,443,787	V18A	probably benign	Het
Apoa5	A	G	9: 46,270,000	K125E	probably benign	Het
Bphl	T	A	13: 34,050,269		probably null	Het
C2cd3	T	A	7: 100,406,927	V514E	probably damaging	Het
C530008M17Rik	C	A	5: 76,857,010	A406E	unknown	Het
C530008M17Rik	C	T	5: 76,857,157	A455V	unknown	Het
Cacna1s	G	A	1: 136,092,694	R823Q	probably benign	Het
Cep192	A	G	18: 67,812,435	D202G	probably benign	Het
Chd5	A	T	4: 152,378,538	N1420Y	probably damaging	Het
Cnot10	A	T	9: 114,631,936	D55E	probably benign	Het
Cntn1	T	A	15: 92,305,246	I803N	probably damaging	Het
Col7a1	G	T	9: 108,975,053	V2217L	unknown	Het
Cpne9	T	G	6: 113,302,118	V491G	probably damaging	Het
Csnk2a1	C	A	2: 152,250,564	H18Q	probably benign	Het
D130040H23Rik	T	A	8: 69,302,651	Y253*	probably null	Het
Dnah14	A	T	1: 181,808,945	M4321L	probably benign	Het
Dnah5	A	G	15: 28,278,624	T1122A	probably benign	Het
Eif4g1	A	G	16: 20,680,745	I515V	probably benign	Het
Fam214a	A	C	9: 75,009,312	N398H	probably damaging	Het
Fbn1	T	C	2: 125,321,691	K2082E	possibly damaging	Het
Fstl1	A	G	16: 37,821,159	K99R	probably benign	Het
Gar1	T	C	3: 129,829,389	N117S	probably damaging	Het
Gm3238	A	T	10: 77,770,910		probably benign	Het
Gm32742	C	T	9: 51,138,714	M1528I	probably benign	Het
H2-T3	T	C	17: 36,189,805	I49V	probably benign	Het
Hyou1	A	G	9: 44,387,264	I581V	probably damaging	Het
Itk	T	C	11: 46,331,935	N563S	probably damaging	Het
Lingo1	A	G	9: 56,619,616	L563P	probably damaging	Het
Lipc	A	G	9: 70,818,847		probably null	Het
Map4k3	A	C	17: 80,630,413		probably null	Het
Mei1	T	A	15: 82,079,945	L229M	possibly damaging	Het
Olfr1501	G	T	19: 13,838,839	C111*	probably null	Het
Olfr309	T	C	7: 86,307,040	I24M	possibly damaging	Het
Pcnx2	A	G	8: 125,861,210	V833A	probably damaging	Het
Pde8b	T	C	13: 95,047,799	N388D	possibly damaging	Het
Pi4ka	G	A	16: 17,303,421	A1197V	possibly damaging	Het
Psd	A	G	19: 46,317,746	Y36H	probably damaging	Het
Scn8a	T	A	15: 100,955,587		probably null	Het
Shisa6	A	G	11: 66,525,501	V155A	probably benign	Het
Slc45a3	T	A	1: 131,977,964	C242S	probably damaging	Het
Sorbs1	G	C	19: 40,376,800	R180G	probably benign	Het
Tmc3	T	A	7: 83,586,357	I54K	probably damaging	Het
Tmprss11g	T	A	5: 86,496,632	I118F	probably benign	Het
Ttn	T	A	2: 76,914,343	D5454V	possibly damaging	Het
Ube2f	A	G	1: 91,254,213		probably null	Het
Ubr7	T	C	12: 102,758,083	S19P	probably damaging	Het
Vav3	T	C	3: 109,521,466	V371A	probably damaging	Het
Vmn2r28	A	G	7: 5,480,807	V798A	probably damaging	Het
Vmn2r95	T	G	17: 18,443,919	C467G	probably damaging	Het
Vmn2r95	G	T	17: 18,443,920	C467F	probably damaging	Het
Vps13b	A	G	15: 35,905,309	D3325G	probably damaging	Het
Wnk2	T	C	13: 49,067,358	T1158A	probably damaging	Het
Zfp616	T	A	11: 74,085,450	N848K	possibly damaging	Het

Other mutations in Mctp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01108:Mctp2	APN	7	72185815	missense	probably damaging	0.96
IGL01296:Mctp2	APN	7	72228526	missense	probably benign	0.03
IGL01509:Mctp2	APN	7	72259269	missense	probably benign	0.01
IGL02074:Mctp2	APN	7	72161258	missense	probably damaging	0.99
IGL02185:Mctp2	APN	7	72080823	missense	probably benign	0.13
IGL02238:Mctp2	APN	7	72090205	nonsense	probably null
IGL02707:Mctp2	APN	7	72259341	missense	possibly damaging	0.95
IGL02820:Mctp2	APN	7	72245542	missense	probably damaging	0.99
IGL02869:Mctp2	APN	7	72228471	critical splice donor site	probably null
IGL03354:Mctp2	APN	7	72161244	missense	probably benign	0.00
IGL03397:Mctp2	APN	7	72259277	missense	probably damaging	0.98
IGL03407:Mctp2	APN	7	72211652	missense	probably benign	0.05
trifecta	UTSW	7	72259331	missense	possibly damaging	0.63
triumvirate	UTSW	7	72211690	missense	probably damaging	1.00
troika	UTSW	7	72185820	missense	probably damaging	1.00
F5770:Mctp2	UTSW	7	72121751	splice site	probably benign
PIT4131001:Mctp2	UTSW	7	72090257	missense	probably damaging	1.00
R0013:Mctp2	UTSW	7	72229408	missense	probably benign	0.00
R0079:Mctp2	UTSW	7	72214116	splice site	probably benign
R0083:Mctp2	UTSW	7	72228516	missense	possibly damaging	0.94
R0173:Mctp2	UTSW	7	72247107	critical splice donor site	probably null
R0302:Mctp2	UTSW	7	72090264	missense	possibly damaging	0.94
R0533:Mctp2	UTSW	7	72080822	missense	probably benign	0.00
R0675:Mctp2	UTSW	7	72083170	missense	probably damaging	1.00
R1076:Mctp2	UTSW	7	72185867	critical splice acceptor site	probably null
R1222:Mctp2	UTSW	7	72259139	missense	probably benign
R1356:Mctp2	UTSW	7	72164723	unclassified	probably benign
R1628:Mctp2	UTSW	7	72211589	splice site	probably null
R1649:Mctp2	UTSW	7	72161258	missense	probably damaging	0.99
R1981:Mctp2	UTSW	7	72164698	missense	probably benign	0.01
R2256:Mctp2	UTSW	7	72185820	missense	probably damaging	1.00
R2257:Mctp2	UTSW	7	72185820	missense	probably damaging	1.00
R2327:Mctp2	UTSW	7	72211610	missense	probably damaging	0.99
R2407:Mctp2	UTSW	7	72200407	missense	probably benign	0.40
R2471:Mctp2	UTSW	7	72161161	nonsense	probably null
R3706:Mctp2	UTSW	7	72214111	splice site	probably benign
R4023:Mctp2	UTSW	7	72090239	missense	possibly damaging	0.88
R4025:Mctp2	UTSW	7	72090239	missense	possibly damaging	0.88
R4176:Mctp2	UTSW	7	72259337	missense	probably benign
R4272:Mctp2	UTSW	7	72259331	missense	possibly damaging	0.63
R4498:Mctp2	UTSW	7	72183851	missense	probably damaging	1.00
R4654:Mctp2	UTSW	7	72090194	missense	probably damaging	1.00
R4815:Mctp2	UTSW	7	72259349	missense	possibly damaging	0.89
R4946:Mctp2	UTSW	7	72259269	missense	probably benign	0.00
R5389:Mctp2	UTSW	7	72214087	missense	possibly damaging	0.50
R5682:Mctp2	UTSW	7	72245459	critical splice donor site	probably null
R5878:Mctp2	UTSW	7	72214108	missense	probably benign	0.01
R5918:Mctp2	UTSW	7	72228540	missense	probably damaging	1.00
R5956:Mctp2	UTSW	7	72259175	missense	probably benign
R5964:Mctp2	UTSW	7	72103177	missense	probably damaging	0.97
R5978:Mctp2	UTSW	7	72090188	missense	probably damaging	1.00
R6054:Mctp2	UTSW	7	72259103	missense	probably benign
R6475:Mctp2	UTSW	7	72200344	critical splice donor site	probably null
R6963:Mctp2	UTSW	7	72228056	missense	probably damaging	1.00
R7366:Mctp2	UTSW	7	72259214	missense	probably benign	0.00
R7468:Mctp2	UTSW	7	72211690	missense	probably damaging	1.00
R7746:Mctp2	UTSW	7	72185796	missense	probably benign
R7765:Mctp2	UTSW	7	72090331	splice site	probably null
R7822:Mctp2	UTSW	7	72127187	missense	possibly damaging	0.90
R7984:Mctp2	UTSW	7	72103189	missense	possibly damaging	0.94
R8416:Mctp2	UTSW	7	72202462	missense	probably benign	0.12
R8678:Mctp2	UTSW	7	72103207	missense	probably damaging	1.00
R8819:Mctp2	UTSW	7	72229333	missense	probably benign	0.20
R8820:Mctp2	UTSW	7	72229333	missense	probably benign	0.20
R8835:Mctp2	UTSW	7	72202413	missense	probably benign	0.19
R8897:Mctp2	UTSW	7	72259563	start codon destroyed	probably benign	0.27
R8898:Mctp2	UTSW	7	72103156	missense	probably damaging	0.99
R9124:Mctp2	UTSW	7	72259430	missense	probably damaging	1.00
X0066:Mctp2	UTSW	7	72259280	nonsense	probably null
Z1191:Mctp2	UTSW	7	72185820	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTGTCCACTCTCAAAGCAAAC -3'
(R):5'- TTTGCTAACTTGAGTCCATGAGAG -3'

Sequencing Primer
(F):5'- AAGGTATTCTTTCCGAGCTAGTC -3'
(R):5'- ATGAGAGTCCCTTCTATTCCAGTAG -3'

Posted On

2018-09-12