Incidental Mutation 'R6849:C2cd3'
ID534911
Institutional Source Beutler Lab
Gene Symbol C2cd3
Ensembl Gene ENSMUSG00000047248
Gene NameC2 calcium-dependent domain containing 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6849 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location100372233-100470152 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 100406927 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 514 (V514E)
Ref Sequence ENSEMBL: ENSMUSP00000062637 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051777] [ENSMUST00000098259] [ENSMUST00000133464]
Predicted Effect probably damaging
Transcript: ENSMUST00000051777
AA Change: V514E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000062637
Gene: ENSMUSG00000047248
AA Change: V514E

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 406 417 N/A INTRINSIC
C2 524 662 2.36e1 SMART
C2 790 899 3.73e0 SMART
C2 989 1129 1.47e1 SMART
C2 1182 1321 1.63e1 SMART
C2 1617 1724 1.43e-2 SMART
low complexity region 1892 1906 N/A INTRINSIC
low complexity region 2037 2049 N/A INTRINSIC
low complexity region 2110 2125 N/A INTRINSIC
low complexity region 2180 2197 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098259
AA Change: V514E

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000095859
Gene: ENSMUSG00000047248
AA Change: V514E

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 406 417 N/A INTRINSIC
C2 524 662 2.36e1 SMART
C2 790 899 3.73e0 SMART
C2 989 1129 1.47e1 SMART
C2 1182 1321 1.63e1 SMART
C2 1617 1724 1.43e-2 SMART
low complexity region 1892 1906 N/A INTRINSIC
low complexity region 2037 2049 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000113360
Gene: ENSMUSG00000047248
AA Change: V136E

DomainStartEndE-ValueType
C2 61 199 2.36e1 SMART
C2 327 436 3.73e0 SMART
C2 526 666 1.47e1 SMART
C2 719 858 1.63e1 SMART
C2 1154 1261 1.43e-2 SMART
low complexity region 1429 1443 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133464
SMART Domains Protein: ENSMUSP00000118864
Gene: ENSMUSG00000047248

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions as a regulator of centriole elongation. Studies of the orthologous mouse protein show that it promotes centriolar distal appendage assembly and is also required for the recruitment of other ciliogenic proteins, including intraflagellar transport proteins. Mutations in this gene cause orofaciodigital syndrome XIV (OFD14), a ciliopathy resulting in malformations of the oral cavity, face and digits. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygotes inactivating allele are embryonic lethal with pericardial edema and twisted body axis, abnormal patterning of brain and open neural tube defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik G T 8: 124,639,522 Q161K probably damaging Het
4930578I06Rik A T 14: 63,986,238 W30R probably damaging Het
4930578I06Rik G T 14: 63,986,239 N29K probably benign Het
Aldh6a1 A G 12: 84,443,787 V18A probably benign Het
Apoa5 A G 9: 46,270,000 K125E probably benign Het
Bphl T A 13: 34,050,269 probably null Het
C530008M17Rik C A 5: 76,857,010 A406E unknown Het
C530008M17Rik C T 5: 76,857,157 A455V unknown Het
Cacna1s G A 1: 136,092,694 R823Q probably benign Het
Cep192 A G 18: 67,812,435 D202G probably benign Het
Chd5 A T 4: 152,378,538 N1420Y probably damaging Het
Cnot10 A T 9: 114,631,936 D55E probably benign Het
Cntn1 T A 15: 92,305,246 I803N probably damaging Het
Col7a1 G T 9: 108,975,053 V2217L unknown Het
Cpne9 T G 6: 113,302,118 V491G probably damaging Het
Csnk2a1 C A 2: 152,250,564 H18Q probably benign Het
D130040H23Rik T A 8: 69,302,651 Y253* probably null Het
Dnah14 A T 1: 181,808,945 M4321L probably benign Het
Dnah5 A G 15: 28,278,624 T1122A probably benign Het
Eif4g1 A G 16: 20,680,745 I515V probably benign Het
Fam214a A C 9: 75,009,312 N398H probably damaging Het
Fbn1 T C 2: 125,321,691 K2082E possibly damaging Het
Fstl1 A G 16: 37,821,159 K99R probably benign Het
Gar1 T C 3: 129,829,389 N117S probably damaging Het
Gm3238 A T 10: 77,770,910 probably benign Het
Gm32742 C T 9: 51,138,714 M1528I probably benign Het
H2-T3 T C 17: 36,189,805 I49V probably benign Het
Hyou1 A G 9: 44,387,264 I581V probably damaging Het
Itk T C 11: 46,331,935 N563S probably damaging Het
Lingo1 A G 9: 56,619,616 L563P probably damaging Het
Lipc A G 9: 70,818,847 probably null Het
Map4k3 A C 17: 80,630,413 probably null Het
Mctp2 C T 7: 72,211,718 C393Y probably damaging Het
Mei1 T A 15: 82,079,945 L229M possibly damaging Het
Olfr1501 G T 19: 13,838,839 C111* probably null Het
Olfr309 T C 7: 86,307,040 I24M possibly damaging Het
Pcnx2 A G 8: 125,861,210 V833A probably damaging Het
Pde8b T C 13: 95,047,799 N388D possibly damaging Het
Pi4ka G A 16: 17,303,421 A1197V possibly damaging Het
Psd A G 19: 46,317,746 Y36H probably damaging Het
Scn8a T A 15: 100,955,587 probably null Het
Shisa6 A G 11: 66,525,501 V155A probably benign Het
Slc45a3 T A 1: 131,977,964 C242S probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Tmc3 T A 7: 83,586,357 I54K probably damaging Het
Tmprss11g T A 5: 86,496,632 I118F probably benign Het
Ttn T A 2: 76,914,343 D5454V possibly damaging Het
Ube2f A G 1: 91,254,213 probably null Het
Ubr7 T C 12: 102,758,083 S19P probably damaging Het
Vav3 T C 3: 109,521,466 V371A probably damaging Het
Vmn2r28 A G 7: 5,480,807 V798A probably damaging Het
Vmn2r95 T G 17: 18,443,919 C467G probably damaging Het
Vmn2r95 G T 17: 18,443,920 C467F probably damaging Het
Vps13b A G 15: 35,905,309 D3325G probably damaging Het
Wnk2 T C 13: 49,067,358 T1158A probably damaging Het
Zfp616 T A 11: 74,085,450 N848K possibly damaging Het
Other mutations in C2cd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:C2cd3 APN 7 100391128 missense probably benign 0.14
IGL01420:C2cd3 APN 7 100454858 missense probably benign 0.35
IGL01775:C2cd3 APN 7 100443431 missense probably damaging 1.00
IGL01832:C2cd3 APN 7 100427214 missense possibly damaging 0.94
IGL01883:C2cd3 APN 7 100374486 missense possibly damaging 0.80
IGL02664:C2cd3 APN 7 100419715 missense possibly damaging 0.67
IGL02697:C2cd3 APN 7 100427169 unclassified probably benign
IGL02852:C2cd3 APN 7 100430189 missense probably damaging 1.00
IGL03158:C2cd3 APN 7 100374476 missense probably damaging 1.00
R0012:C2cd3 UTSW 7 100418522 missense possibly damaging 0.52
R0012:C2cd3 UTSW 7 100418522 missense possibly damaging 0.52
R0013:C2cd3 UTSW 7 100416062 missense probably damaging 1.00
R0013:C2cd3 UTSW 7 100416062 missense probably damaging 1.00
R0032:C2cd3 UTSW 7 100444445 unclassified probably benign
R0032:C2cd3 UTSW 7 100444445 unclassified probably benign
R0124:C2cd3 UTSW 7 100469518 missense probably benign
R0387:C2cd3 UTSW 7 100422507 splice site probably benign
R0522:C2cd3 UTSW 7 100395222 missense probably benign 0.14
R1124:C2cd3 UTSW 7 100422681 missense probably benign 0.00
R1484:C2cd3 UTSW 7 100440190 missense probably damaging 1.00
R1533:C2cd3 UTSW 7 100406077 missense possibly damaging 0.54
R1631:C2cd3 UTSW 7 100372497 critical splice donor site probably null
R1875:C2cd3 UTSW 7 100407025 missense possibly damaging 0.89
R2059:C2cd3 UTSW 7 100455493 unclassified probably benign
R2060:C2cd3 UTSW 7 100454948 missense probably damaging 1.00
R2348:C2cd3 UTSW 7 100413366 missense probably damaging 1.00
R3103:C2cd3 UTSW 7 100395252 missense possibly damaging 0.47
R3405:C2cd3 UTSW 7 100390166 missense probably benign 0.01
R3687:C2cd3 UTSW 7 100435833 missense probably benign 0.28
R3775:C2cd3 UTSW 7 100431998 missense probably damaging 1.00
R3854:C2cd3 UTSW 7 100454601 critical splice acceptor site probably null
R4359:C2cd3 UTSW 7 100441089 missense probably damaging 1.00
R4403:C2cd3 UTSW 7 100432099 missense probably damaging 1.00
R4446:C2cd3 UTSW 7 100374477 missense probably damaging 1.00
R4646:C2cd3 UTSW 7 100372450 unclassified probably benign
R4705:C2cd3 UTSW 7 100395188 missense possibly damaging 0.77
R4770:C2cd3 UTSW 7 100443435 missense probably damaging 1.00
R4777:C2cd3 UTSW 7 100416332 missense possibly damaging 0.46
R4816:C2cd3 UTSW 7 100391019 missense probably benign 0.01
R4842:C2cd3 UTSW 7 100416190 missense probably benign 0.00
R4858:C2cd3 UTSW 7 100454953 missense probably damaging 1.00
R4871:C2cd3 UTSW 7 100413374 missense possibly damaging 0.79
R4898:C2cd3 UTSW 7 100405959 missense probably damaging 1.00
R5026:C2cd3 UTSW 7 100459842 missense possibly damaging 0.52
R5112:C2cd3 UTSW 7 100443485 missense possibly damaging 0.91
R5242:C2cd3 UTSW 7 100390166 missense probably benign 0.01
R5538:C2cd3 UTSW 7 100455493 critical splice donor site probably null
R5861:C2cd3 UTSW 7 100444475 unclassified probably benign
R6110:C2cd3 UTSW 7 100441076 missense probably damaging 1.00
R6326:C2cd3 UTSW 7 100416428 missense probably benign 0.02
R6429:C2cd3 UTSW 7 100432091 missense probably damaging 1.00
R6610:C2cd3 UTSW 7 100455298 missense probably benign
R6613:C2cd3 UTSW 7 100395241 missense possibly damaging 0.87
R6631:C2cd3 UTSW 7 100418540 missense probably damaging 1.00
R6787:C2cd3 UTSW 7 100455346 missense probably benign
R6837:C2cd3 UTSW 7 100448746 missense probably damaging 1.00
R6860:C2cd3 UTSW 7 100390241 missense probably benign 0.28
R6929:C2cd3 UTSW 7 100451619 missense probably damaging 1.00
R7026:C2cd3 UTSW 7 100432092 missense probably damaging 1.00
R7088:C2cd3 UTSW 7 100416181 missense
R7174:C2cd3 UTSW 7 100432198 missense
R7241:C2cd3 UTSW 7 100407050 missense
R7335:C2cd3 UTSW 7 100422603 missense
R7357:C2cd3 UTSW 7 100430103 missense
R7493:C2cd3 UTSW 7 100427226 missense
R7567:C2cd3 UTSW 7 100430815 missense
R7573:C2cd3 UTSW 7 100419707 missense
R7869:C2cd3 UTSW 7 100469491 missense probably damaging 0.99
R7999:C2cd3 UTSW 7 100459889 critical splice donor site probably null
R8134:C2cd3 UTSW 7 100418504 missense
R8369:C2cd3 UTSW 7 100395258 missense probably benign 0.03
R8372:C2cd3 UTSW 7 100455280 nonsense probably null
X0002:C2cd3 UTSW 7 100440235 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- CACAGAGCCGTTCCTATTTCAC -3'
(R):5'- TAAGTTAGACTTCCTATTACCAGCC -3'

Sequencing Primer
(F):5'- AGAGCCGTTCCTATTTCACTTTGAAC -3'
(R):5'- TAGCCCCGAATGCCACATTTAG -3'
Posted On2018-09-12