Incidental Mutation 'R6849:Itk'
ID534924
Institutional Source Beutler Lab
Gene Symbol Itk
Ensembl Gene ENSMUSG00000020395
Gene NameIL2 inducible T cell kinase
SynonymsEmt, Tsk, Tcsk
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R6849 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location46325150-46389515 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46331935 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 563 (N563S)
Ref Sequence ENSEMBL: ENSMUSP00000020664 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020664] [ENSMUST00000109237]
Predicted Effect probably damaging
Transcript: ENSMUST00000020664
AA Change: N563S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020664
Gene: ENSMUSG00000020395
AA Change: N563S

DomainStartEndE-ValueType
PH 5 113 2.3e-13 SMART
BTK 113 149 1.1e-21 SMART
SH3 174 230 5.87e-14 SMART
SH2 237 328 9.44e-29 SMART
TyrKc 362 611 3.28e-133 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109237
AA Change: N569S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000104860
Gene: ENSMUSG00000020395
AA Change: N569S

DomainStartEndE-ValueType
PH 5 119 3.94e-12 SMART
BTK 119 155 1.1e-21 SMART
SH3 180 236 5.87e-14 SMART
SH2 243 334 9.44e-29 SMART
TyrKc 368 617 3.28e-133 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intracellular tyrosine kinase expressed in T-cells. The protein contains both SH2 and SH3 domains which are often found in intracellular kinases. It is thought to play a role in T-cell proliferation and differentiation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display decreased percentages of CD4 and CD8 cells, increased percentage of B cells, impaired T cell receptor signaling, and increased susceptibility to Toxoplasma gondii infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik G T 8: 124,639,522 Q161K probably damaging Het
4930578I06Rik A T 14: 63,986,238 W30R probably damaging Het
4930578I06Rik G T 14: 63,986,239 N29K probably benign Het
Aldh6a1 A G 12: 84,443,787 V18A probably benign Het
Apoa5 A G 9: 46,270,000 K125E probably benign Het
Bphl T A 13: 34,050,269 probably null Het
C2cd3 T A 7: 100,406,927 V514E probably damaging Het
C530008M17Rik C A 5: 76,857,010 A406E unknown Het
C530008M17Rik C T 5: 76,857,157 A455V unknown Het
Cacna1s G A 1: 136,092,694 R823Q probably benign Het
Cep192 A G 18: 67,812,435 D202G probably benign Het
Chd5 A T 4: 152,378,538 N1420Y probably damaging Het
Cnot10 A T 9: 114,631,936 D55E probably benign Het
Cntn1 T A 15: 92,305,246 I803N probably damaging Het
Col7a1 G T 9: 108,975,053 V2217L unknown Het
Cpne9 T G 6: 113,302,118 V491G probably damaging Het
Csnk2a1 C A 2: 152,250,564 H18Q probably benign Het
D130040H23Rik T A 8: 69,302,651 Y253* probably null Het
Dnah14 A T 1: 181,808,945 M4321L probably benign Het
Dnah5 A G 15: 28,278,624 T1122A probably benign Het
Eif4g1 A G 16: 20,680,745 I515V probably benign Het
Fam214a A C 9: 75,009,312 N398H probably damaging Het
Fbn1 T C 2: 125,321,691 K2082E possibly damaging Het
Fstl1 A G 16: 37,821,159 K99R probably benign Het
Gar1 T C 3: 129,829,389 N117S probably damaging Het
Gm3238 A T 10: 77,770,910 probably benign Het
Gm32742 C T 9: 51,138,714 M1528I probably benign Het
H2-T3 T C 17: 36,189,805 I49V probably benign Het
Hyou1 A G 9: 44,387,264 I581V probably damaging Het
Lingo1 A G 9: 56,619,616 L563P probably damaging Het
Lipc A G 9: 70,818,847 probably null Het
Map4k3 A C 17: 80,630,413 probably null Het
Mctp2 C T 7: 72,211,718 C393Y probably damaging Het
Mei1 T A 15: 82,079,945 L229M possibly damaging Het
Olfr1501 G T 19: 13,838,839 C111* probably null Het
Olfr309 T C 7: 86,307,040 I24M possibly damaging Het
Pcnx2 A G 8: 125,861,210 V833A probably damaging Het
Pde8b T C 13: 95,047,799 N388D possibly damaging Het
Pi4ka G A 16: 17,303,421 A1197V possibly damaging Het
Psd A G 19: 46,317,746 Y36H probably damaging Het
Scn8a T A 15: 100,955,587 probably null Het
Shisa6 A G 11: 66,525,501 V155A probably benign Het
Slc45a3 T A 1: 131,977,964 C242S probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Tmc3 T A 7: 83,586,357 I54K probably damaging Het
Tmprss11g T A 5: 86,496,632 I118F probably benign Het
Ttn T A 2: 76,914,343 D5454V possibly damaging Het
Ube2f A G 1: 91,254,213 probably null Het
Ubr7 T C 12: 102,758,083 S19P probably damaging Het
Vav3 T C 3: 109,521,466 V371A probably damaging Het
Vmn2r28 A G 7: 5,480,807 V798A probably damaging Het
Vmn2r95 T G 17: 18,443,919 C467G probably damaging Het
Vmn2r95 G T 17: 18,443,920 C467F probably damaging Het
Vps13b A G 15: 35,905,309 D3325G probably damaging Het
Wnk2 T C 13: 49,067,358 T1158A probably damaging Het
Zfp616 T A 11: 74,085,450 N848K possibly damaging Het
Other mutations in Itk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Itk APN 11 46367896 missense probably damaging 1.00
IGL01349:Itk APN 11 46341200 missense possibly damaging 0.84
IGL03290:Itk APN 11 46334937 missense probably damaging 1.00
IGL03385:Itk APN 11 46331861 nonsense probably null
Calame UTSW 11 46342395 splice site probably null
carbone UTSW 11 46331949 nonsense probably null
goodnow UTSW 11 46338099 splice site probably null
itxaro UTSW 11 46338217 missense probably damaging 1.00
BB009:Itk UTSW 11 46340692 missense probably benign
BB019:Itk UTSW 11 46340692 missense probably benign
R0095:Itk UTSW 11 46342452 missense probably damaging 0.99
R0265:Itk UTSW 11 46389458 start gained probably benign
R0281:Itk UTSW 11 46353916 missense probably damaging 1.00
R0463:Itk UTSW 11 46331989 missense probably damaging 1.00
R0518:Itk UTSW 11 46360288 missense probably damaging 0.98
R0521:Itk UTSW 11 46360288 missense probably damaging 0.98
R1121:Itk UTSW 11 46331894 missense possibly damaging 0.93
R1550:Itk UTSW 11 46389326 missense probably damaging 1.00
R1762:Itk UTSW 11 46336482 missense probably damaging 0.98
R2418:Itk UTSW 11 46338217 missense probably damaging 1.00
R2419:Itk UTSW 11 46338217 missense probably damaging 1.00
R2859:Itk UTSW 11 46344835 intron probably benign
R3107:Itk UTSW 11 46327464 missense probably benign 0.15
R3546:Itk UTSW 11 46355848 missense probably benign 0.00
R4601:Itk UTSW 11 46336515 missense probably benign 0.17
R4610:Itk UTSW 11 46336515 missense probably benign 0.17
R4792:Itk UTSW 11 46344831 intron probably benign
R4885:Itk UTSW 11 46336344 splice site probably null
R4934:Itk UTSW 11 46389325 missense probably damaging 1.00
R5286:Itk UTSW 11 46338099 splice site probably null
R5328:Itk UTSW 11 46331876 missense probably benign 0.04
R5399:Itk UTSW 11 46338111 missense probably benign 0.44
R5958:Itk UTSW 11 46344855 intron probably benign
R6235:Itk UTSW 11 46336428 missense probably benign 0.16
R6828:Itk UTSW 11 46341218 missense probably damaging 1.00
R7356:Itk UTSW 11 46367832 missense possibly damaging 0.72
R7753:Itk UTSW 11 46331895 missense probably damaging 1.00
R7932:Itk UTSW 11 46340692 missense probably benign
R7988:Itk UTSW 11 46355834 missense probably damaging 0.99
R8188:Itk UTSW 11 46331949 nonsense probably null
R8337:Itk UTSW 11 46342395 splice site probably null
R8738:Itk UTSW 11 46340712 missense probably damaging 1.00
U24488:Itk UTSW 11 46338144 missense probably damaging 1.00
X0062:Itk UTSW 11 46366044 missense probably benign 0.15
Z1088:Itk UTSW 11 46353862 splice site probably null
Predicted Primers PCR Primer
(F):5'- AAACACGGACAAAGTCTGGC -3'
(R):5'- GAGGGGTGGACTTAATACTCACTAC -3'

Sequencing Primer
(F):5'- GACAAAGTCTGGCCTGTTTATTACG -3'
(R):5'- GGTGGACTTAATACTCACTACAAGGC -3'
Posted On2018-09-12