Incidental Mutation 'R6849:Ubr7'
ID534928
Institutional Source Beutler Lab
Gene Symbol Ubr7
Ensembl Gene ENSMUSG00000041712
Gene Nameubiquitin protein ligase E3 component n-recognin 7 (putative)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.404) question?
Stock #R6849 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location102757967-102777707 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102758083 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 19 (S19P)
Ref Sequence ENSEMBL: ENSMUSP00000041247 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046404] [ENSMUST00000173969] [ENSMUST00000174651] [ENSMUST00000179263] [ENSMUST00000179306]
Predicted Effect probably damaging
Transcript: ENSMUST00000046404
AA Change: S19P

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000041247
Gene: ENSMUSG00000041712
AA Change: S19P

DomainStartEndE-ValueType
low complexity region 13 33 N/A INTRINSIC
Pfam:zf-UBR 45 113 2.4e-15 PFAM
PHD 134 186 1.78e-1 SMART
low complexity region 261 267 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173969
SMART Domains Protein: ENSMUSP00000136425
Gene: ENSMUSG00000091931

DomainStartEndE-ValueType
Pfam:DUF4611 3 96 7.7e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174651
SMART Domains Protein: ENSMUSP00000133604
Gene: ENSMUSG00000041716

DomainStartEndE-ValueType
Pfam:DUF4611 3 73 8.6e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179263
SMART Domains Protein: ENSMUSP00000137212
Gene: ENSMUSG00000091931

DomainStartEndE-ValueType
Pfam:DUF4611 3 77 7.8e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179306
SMART Domains Protein: ENSMUSP00000136193
Gene: ENSMUSG00000098530

DomainStartEndE-ValueType
Pfam:DUF4611 3 77 1.5e-28 PFAM
Meta Mutation Damage Score 0.5874 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a UBR box-containing protein that belongs to the E3 ubiquitin ligase family. The protein also contains a plant homeodomain (PHD) in the C-terminus. In mammals, the encoded protein recognizes N-degrons, the destabilizing N-terminal residues of short-lived proteins, which results in ubiquitinylation, and proteolysis via the proteasome. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik G T 8: 124,639,522 Q161K probably damaging Het
4930578I06Rik A T 14: 63,986,238 W30R probably damaging Het
4930578I06Rik G T 14: 63,986,239 N29K probably benign Het
Aldh6a1 A G 12: 84,443,787 V18A probably benign Het
Apoa5 A G 9: 46,270,000 K125E probably benign Het
Bphl T A 13: 34,050,269 probably null Het
C2cd3 T A 7: 100,406,927 V514E probably damaging Het
C530008M17Rik C A 5: 76,857,010 A406E unknown Het
C530008M17Rik C T 5: 76,857,157 A455V unknown Het
Cacna1s G A 1: 136,092,694 R823Q probably benign Het
Cep192 A G 18: 67,812,435 D202G probably benign Het
Chd5 A T 4: 152,378,538 N1420Y probably damaging Het
Cnot10 A T 9: 114,631,936 D55E probably benign Het
Cntn1 T A 15: 92,305,246 I803N probably damaging Het
Col7a1 G T 9: 108,975,053 V2217L unknown Het
Cpne9 T G 6: 113,302,118 V491G probably damaging Het
Csnk2a1 C A 2: 152,250,564 H18Q probably benign Het
D130040H23Rik T A 8: 69,302,651 Y253* probably null Het
Dnah14 A T 1: 181,808,945 M4321L probably benign Het
Dnah5 A G 15: 28,278,624 T1122A probably benign Het
Eif4g1 A G 16: 20,680,745 I515V probably benign Het
Fam214a A C 9: 75,009,312 N398H probably damaging Het
Fbn1 T C 2: 125,321,691 K2082E possibly damaging Het
Fstl1 A G 16: 37,821,159 K99R probably benign Het
Gar1 T C 3: 129,829,389 N117S probably damaging Het
Gm3238 A T 10: 77,770,910 probably benign Het
Gm32742 C T 9: 51,138,714 M1528I probably benign Het
H2-T3 T C 17: 36,189,805 I49V probably benign Het
Hyou1 A G 9: 44,387,264 I581V probably damaging Het
Itk T C 11: 46,331,935 N563S probably damaging Het
Lingo1 A G 9: 56,619,616 L563P probably damaging Het
Lipc A G 9: 70,818,847 probably null Het
Map4k3 A C 17: 80,630,413 probably null Het
Mctp2 C T 7: 72,211,718 C393Y probably damaging Het
Mei1 T A 15: 82,079,945 L229M possibly damaging Het
Olfr1501 G T 19: 13,838,839 C111* probably null Het
Olfr309 T C 7: 86,307,040 I24M possibly damaging Het
Pcnx2 A G 8: 125,861,210 V833A probably damaging Het
Pde8b T C 13: 95,047,799 N388D possibly damaging Het
Pi4ka G A 16: 17,303,421 A1197V possibly damaging Het
Psd A G 19: 46,317,746 Y36H probably damaging Het
Scn8a T A 15: 100,955,587 probably null Het
Shisa6 A G 11: 66,525,501 V155A probably benign Het
Slc45a3 T A 1: 131,977,964 C242S probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Tmc3 T A 7: 83,586,357 I54K probably damaging Het
Tmprss11g T A 5: 86,496,632 I118F probably benign Het
Ttn T A 2: 76,914,343 D5454V possibly damaging Het
Ube2f A G 1: 91,254,213 probably null Het
Vav3 T C 3: 109,521,466 V371A probably damaging Het
Vmn2r28 A G 7: 5,480,807 V798A probably damaging Het
Vmn2r95 T G 17: 18,443,919 C467G probably damaging Het
Vmn2r95 G T 17: 18,443,920 C467F probably damaging Het
Vps13b A G 15: 35,905,309 D3325G probably damaging Het
Wnk2 T C 13: 49,067,358 T1158A probably damaging Het
Zfp616 T A 11: 74,085,450 N848K possibly damaging Het
Other mutations in Ubr7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02152:Ubr7 APN 12 102768276 nonsense probably null
IGL02493:Ubr7 APN 12 102768220 missense probably benign 0.00
IGL02750:Ubr7 APN 12 102771278 missense possibly damaging 0.68
IGL03229:Ubr7 APN 12 102769155 missense probably damaging 1.00
dwindled UTSW 12 102761464 missense probably damaging 1.00
R0519:Ubr7 UTSW 12 102768206 missense probably benign 0.00
R0894:Ubr7 UTSW 12 102769191 missense probably damaging 1.00
R1453:Ubr7 UTSW 12 102769178 missense probably benign 0.00
R1598:Ubr7 UTSW 12 102769894 missense probably damaging 1.00
R2201:Ubr7 UTSW 12 102761505 critical splice donor site probably null
R4731:Ubr7 UTSW 12 102769226 missense probably benign 0.03
R4834:Ubr7 UTSW 12 102761502 missense probably damaging 1.00
R5222:Ubr7 UTSW 12 102775705 missense probably benign 0.09
R5662:Ubr7 UTSW 12 102768267 missense probably benign 0.00
R5845:Ubr7 UTSW 12 102766312 missense probably damaging 0.99
R5867:Ubr7 UTSW 12 102761494 missense probably damaging 1.00
R6257:Ubr7 UTSW 12 102765840 nonsense probably null
R6543:Ubr7 UTSW 12 102768235 missense probably benign 0.01
R6601:Ubr7 UTSW 12 102761464 missense probably damaging 1.00
R7330:Ubr7 UTSW 12 102775712 missense probably damaging 0.99
R7576:Ubr7 UTSW 12 102769139 missense probably damaging 1.00
R8256:Ubr7 UTSW 12 102769911 missense probably damaging 1.00
R8334:Ubr7 UTSW 12 102758138 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATTGGCCCGCCCATTTTC -3'
(R):5'- CTGAGGATGAAATGGCAGCC -3'

Sequencing Primer
(F):5'- CTTCCTTAGGATTGGCTGTCTG -3'
(R):5'- CACAGAGTAAAGGGCCGCC -3'
Posted On2018-09-12