Incidental Mutation 'R6851:Hadh'
ID534961
Institutional Source Beutler Lab
Gene Symbol Hadh
Ensembl Gene ENSMUSG00000027984
Gene Namehydroxyacyl-Coenzyme A dehydrogenase
SynonymsHadhsc, Schad
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock #R6851 (G1)
Quality Score177.009
Status Validated
Chromosome3
Chromosomal Location131233419-131272101 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 131271971 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 13 (S13P)
Ref Sequence ENSEMBL: ENSMUSP00000029610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029610]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029610
AA Change: S13P

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000029610
Gene: ENSMUSG00000027984
AA Change: S13P

DomainStartEndE-ValueType
Pfam:Pyr_redox_2 4 87 1.2e-7 PFAM
Pfam:3HCDH_N 29 214 1.4e-66 PFAM
Pfam:3HCDH 216 313 7e-36 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the 3-hydroxyacyl-CoA dehydrogenase gene family. The encoded protein functions in the mitochondrial matrix to catalyze the oxidation of straight-chain 3-hydroxyacyl-CoAs as part of the beta-oxidation pathway. Its enzymatic activity is highest with medium-chain-length fatty acids. Mutations in this gene cause one form of familial hyperinsulinemic hypoglycemia. The human genome contains a related pseudogene of this gene on chromosome 15. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit decreased susceptibility to diet-induced obesity associated with impaired fatty acid oxidation, impaired fat tolerance, decreased ketone bodies, and increased glucose-stimulated insulin secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,312,419 C856S probably benign Het
Arrdc2 T C 8: 70,838,725 E153G probably damaging Het
BC051142 A T 17: 34,460,172 Y303F possibly damaging Het
BC055324 G A 1: 163,964,767 R554C probably damaging Het
Cacna1d T C 14: 30,042,782 D2033G probably damaging Het
Cacna1s G A 1: 136,092,694 R823Q probably benign Het
Cracr2a A T 6: 127,608,716 D159V probably damaging Het
Defa35 T C 8: 21,065,130 I22T possibly damaging Het
Dgke T C 11: 89,052,483 T227A probably benign Het
Galnt10 G A 11: 57,765,632 R214Q probably damaging Het
Gm11639 G A 11: 105,005,695 R4290K probably benign Het
Gpr180 T C 14: 118,153,625 Y189H probably damaging Het
Hcn2 T A 10: 79,729,113 probably null Het
Irgm2 T C 11: 58,219,815 S123P possibly damaging Het
Kcnv1 T A 15: 45,109,198 I430F probably damaging Het
Kif13b G A 14: 64,773,065 C1271Y probably damaging Het
Klhdc3 A T 17: 46,678,292 I48N possibly damaging Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Mprip T A 11: 59,759,015 W1182R probably damaging Het
Mycbp2 A T 14: 103,260,194 probably null Het
Olfr1099 T C 2: 86,959,267 T64A possibly damaging Het
Olfr1112 T A 2: 87,192,469 S261T probably benign Het
Olfr1160 T A 2: 88,005,956 H265L probably damaging Het
Olfr339 T A 2: 36,421,820 C141S probably damaging Het
Olfr916 A G 9: 38,658,185 V69A probably benign Het
Osbpl8 T A 10: 111,270,618 Y295* probably null Het
Pex5 A G 6: 124,403,154 S275P possibly damaging Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Sele G T 1: 164,053,952 G543C probably damaging Het
Serpina3k A C 12: 104,345,366 Y401S probably benign Het
Slc13a4 A G 6: 35,301,733 S74P probably damaging Het
Spata31d1a A G 13: 59,703,911 L114P unknown Het
Syne1 G T 10: 5,262,703 C3295* probably null Het
Tepsin G T 11: 120,096,961 H44N probably damaging Het
Tpp1 A T 7: 105,749,712 V170E probably damaging Het
Trav3-1 T C 14: 52,580,971 V34A probably damaging Het
Ush2a T C 1: 188,533,205 V1642A probably benign Het
Vmn1r122 A G 7: 21,133,920 I70T probably benign Het
Vmn2r96 A G 17: 18,582,538 M237V possibly damaging Het
Wdr75 A G 1: 45,823,427 E802G probably benign Het
Zan G A 5: 137,396,191 T4462I unknown Het
Other mutations in Hadh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Hadh APN 3 131249816 missense probably benign
IGL01062:Hadh APN 3 131240991 missense probably damaging 1.00
IGL01106:Hadh APN 3 131240970 missense possibly damaging 0.89
IGL02629:Hadh APN 3 131235635 missense probably damaging 1.00
IGL02717:Hadh APN 3 131249910 missense probably benign
IGL03180:Hadh APN 3 131271884 missense probably benign 0.08
IGL03240:Hadh APN 3 131248543 missense probably benign
R0081:Hadh UTSW 3 131235636 missense probably damaging 1.00
R1687:Hadh UTSW 3 131245249 missense probably benign 0.00
R2000:Hadh UTSW 3 131245239 missense probably benign 0.11
R4989:Hadh UTSW 3 131235548 nonsense probably null
R8787:Hadh UTSW 3 131234176 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTAGTTCTGGGACACTGAAGC -3'
(R):5'- AACTACAGGTTGTCTCTTGGTG -3'

Sequencing Primer
(F):5'- TCTGGGACACTGAAGCATGCTG -3'
(R):5'- TCCTCGGCTGCTGCACT -3'
Posted On2018-09-12