Incidental Mutation 'R6852:Lhx9'
ID 534995
Institutional Source Beutler Lab
Gene Symbol Lhx9
Ensembl Gene ENSMUSG00000019230
Gene Name LIM homeobox protein 9
Synonyms 3110009O07Rik, Lhx9 alpha, LH2B
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.828) question?
Stock # R6852 (G1)
Quality Score 217.468
Status Not validated
Chromosome 1
Chromosomal Location 138825186-138848577 bp(-) (GRCm38)
Type of Mutation frame shift
DNA Base Change (assembly) ACC to ACCC at 138841806 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019374] [ENSMUST00000046870] [ENSMUST00000093486] [ENSMUST00000112026] [ENSMUST00000112030] [ENSMUST00000194557]
AlphaFold Q9WUH2
Predicted Effect probably null
Transcript: ENSMUST00000019374
SMART Domains Protein: ENSMUSP00000019374
Gene: ENSMUSG00000019230

DomainStartEndE-ValueType
LIM 70 123 4.48e-17 SMART
LIM 132 186 8.04e-19 SMART
HOX 267 319 1.89e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000046870
SMART Domains Protein: ENSMUSP00000036480
Gene: ENSMUSG00000019230

DomainStartEndE-ValueType
LIM 61 114 4.48e-17 SMART
LIM 123 177 8.04e-19 SMART
HOX 258 320 8.07e-22 SMART
low complexity region 344 368 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000093486
SMART Domains Protein: ENSMUSP00000091198
Gene: ENSMUSG00000019230

DomainStartEndE-ValueType
LIM 61 114 4.48e-17 SMART
LIM 123 177 8.04e-19 SMART
HOX 258 310 1.89e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000112026
SMART Domains Protein: ENSMUSP00000107657
Gene: ENSMUSG00000019230

DomainStartEndE-ValueType
LIM 70 123 4.48e-17 SMART
LIM 132 186 8.04e-19 SMART
HOX 267 329 8.07e-22 SMART
low complexity region 353 377 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112030
SMART Domains Protein: ENSMUSP00000107661
Gene: ENSMUSG00000019230

DomainStartEndE-ValueType
LIM 61 114 4.48e-17 SMART
LIM 123 177 8.04e-19 SMART
HOX 258 310 1.89e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000194557
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the LIM homeobox gene family of developmentally expressed transcription factors. The encoded protein contains a homeodomain and two cysteine-rich zinc-binding LIM domains involved in protein-protein interactions. The protein is highly similar to a mouse protein that causes gonadal agenesis when inactivated, suggesting a role in gonadal development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit failed proliferation of the somatic cells of the genital ridge resulting in lack of discrete gonad formation, infertility in both sexes, and female-like genitalia in genetically male mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,065,169 Q40* probably null Het
1700034E13Rik T C 18: 52,663,633 V81A probably damaging Het
2310035C23Rik T C 1: 105,753,595 L1184P probably damaging Het
5330417C22Rik T C 3: 108,482,338 E203G probably damaging Het
9530053A07Rik T A 7: 28,147,135 I1084N probably damaging Het
A630089N07Rik A G 16: 98,065,655 I369T probably benign Het
Aatk T A 11: 120,010,468 Q977L probably benign Het
Abca4 A T 3: 122,135,195 Q144H probably damaging Het
Ampd3 T C 7: 110,802,546 F416L probably benign Het
Anks1b A G 10: 90,260,654 E425G probably damaging Het
Atm A G 9: 53,482,430 S1737P possibly damaging Het
Bsph1 T A 7: 13,470,330 probably null Het
Cabyr C T 18: 12,754,097 P262S probably benign Het
Cdc14a G A 3: 116,328,676 P214L possibly damaging Het
Cep128 C A 12: 91,366,342 probably null Het
Cfh T A 1: 140,147,749 R250S probably damaging Het
Ddx39 T C 8: 83,723,017 I417T probably benign Het
Dgka T A 10: 128,722,539 K548M probably damaging Het
Efr3a G A 15: 65,829,830 V198I probably benign Het
Epg5 C T 18: 78,012,891 T1760I probably damaging Het
Fat1 T C 8: 45,035,598 V3472A possibly damaging Het
Fbxo48 T A 11: 16,953,402 N9K probably benign Het
Fer1l6 A T 15: 58,594,878 H833L probably damaging Het
Foxn1 G T 11: 78,360,960 Q482K probably benign Het
Fstl5 A G 3: 76,707,855 D741G probably damaging Het
Gm8909 T C 17: 36,168,073 N95D possibly damaging Het
Gmip C T 8: 69,817,991 Q55* probably null Het
Hapln2 G A 3: 88,022,651 T306M possibly damaging Het
Kat6a T A 8: 22,938,660 S1344T probably benign Het
Kctd1 C T 18: 14,986,344 D705N possibly damaging Het
Micall2 G T 5: 139,715,793 A482D possibly damaging Het
Mindy3 T A 2: 12,419,252 M1L possibly damaging Het
Mtdh A G 15: 34,136,721 E352G probably damaging Het
Muc5ac G A 7: 141,816,907 V3219I probably benign Het
Myh4 A G 11: 67,252,968 probably null Het
Ncor1 A G 11: 62,343,245 I377T probably damaging Het
Olfr1034 A T 2: 86,046,604 I41F probably benign Het
Oog4 C A 4: 143,439,109 C156F possibly damaging Het
Pcyt1a T C 16: 32,470,120 S260P probably damaging Het
Phf3 A T 1: 30,804,630 F1749L probably damaging Het
Prickle2 T C 6: 92,376,544 D647G probably benign Het
Raver2 T C 4: 101,133,590 S387P probably benign Het
Rgs19 A G 2: 181,689,148 S231P possibly damaging Het
Rpl8 G T 15: 76,905,949 R198L probably benign Het
Sacs T A 14: 61,179,288 S77T possibly damaging Het
Samd14 G A 11: 95,021,454 G219D probably damaging Het
Sec16a C T 2: 26,441,419 V195M probably damaging Het
Sesn2 C T 4: 132,493,802 V453I possibly damaging Het
Slc46a3 A T 5: 147,886,160 C291S probably damaging Het
Smarcal1 A G 1: 72,591,173 T129A possibly damaging Het
Sorl1 T A 9: 42,024,398 R1041W possibly damaging Het
Sptlc3 T C 2: 139,566,586 I207T probably benign Het
Srgap3 T C 6: 112,816,661 D118G probably damaging Het
Tas2r117 T A 6: 132,802,929 V10D probably benign Het
Tbcd A G 11: 121,609,380 K1111E probably benign Het
Tor1aip1 A T 1: 156,035,820 L139Q probably damaging Het
Trbv23 T C 6: 41,216,247 V23A probably damaging Het
Ttll3 GGCAAAG GGCAAAGCAAAG 6: 113,399,155 probably null Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Ttll3 AAGTA AAGTATAGTA 6: 113,399,159 probably null Het
Vmn1r42 T G 6: 89,844,787 T267P possibly damaging Het
Vmn2r53 C A 7: 12,606,514 V11F probably damaging Het
Vmn2r67 T C 7: 85,152,153 M192V probably damaging Het
Vmn2r78 T C 7: 86,954,603 V663A probably damaging Het
Zdhhc1 C T 8: 105,477,072 G156S possibly damaging Het
Zfp318 GAAGAA GAAGAAAAAGAA 17: 46,412,533 probably benign Het
Zfp318 AAGAAG AAGAAGTAGAAG 17: 46,412,534 probably benign Het
Zfp318 AGAAG AGAAGAGGAAG 17: 46,412,538 probably benign Het
Zfp560 A G 9: 20,348,043 C508R probably damaging Het
Zfp654 G A 16: 64,786,598 L414F probably damaging Het
Zfp872 A T 9: 22,200,059 Y278F probably damaging Het
Zscan20 T C 4: 128,589,722 S385G probably damaging Het
Other mutations in Lhx9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Lhx9 APN 1 138828680 missense possibly damaging 0.74
IGL01624:Lhx9 APN 1 138832783 nonsense probably null
IGL02149:Lhx9 APN 1 138831434 missense probably damaging 1.00
IGL02452:Lhx9 APN 1 138841842 missense probably damaging 1.00
IGL02982:Lhx9 APN 1 138838611 missense probably damaging 1.00
R0123:Lhx9 UTSW 1 138838679 missense probably damaging 1.00
R0134:Lhx9 UTSW 1 138838679 missense probably damaging 1.00
R0141:Lhx9 UTSW 1 138840006 missense possibly damaging 0.86
R0225:Lhx9 UTSW 1 138838679 missense probably damaging 1.00
R0281:Lhx9 UTSW 1 138832904 missense probably benign 0.00
R1460:Lhx9 UTSW 1 138838709 splice site probably benign
R1932:Lhx9 UTSW 1 138842009 start gained probably benign
R4738:Lhx9 UTSW 1 138832748 missense probably damaging 1.00
R4792:Lhx9 UTSW 1 138838351 missense possibly damaging 0.87
R4820:Lhx9 UTSW 1 138838367 missense probably benign 0.00
R4877:Lhx9 UTSW 1 138838354 missense probably benign 0.04
R6035:Lhx9 UTSW 1 138838543 missense possibly damaging 0.67
R6035:Lhx9 UTSW 1 138838543 missense possibly damaging 0.67
R6825:Lhx9 UTSW 1 138841806 frame shift probably null
R6853:Lhx9 UTSW 1 138841806 frame shift probably null
R7264:Lhx9 UTSW 1 138832751 missense probably damaging 0.98
R8097:Lhx9 UTSW 1 138838351 missense probably damaging 0.97
R8164:Lhx9 UTSW 1 138832780 missense probably damaging 1.00
R8245:Lhx9 UTSW 1 138838441 missense probably benign 0.24
R8278:Lhx9 UTSW 1 138838586 missense probably damaging 0.98
R8951:Lhx9 UTSW 1 138841966 missense probably damaging 1.00
Z1177:Lhx9 UTSW 1 138831498 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGACTGGAGAGCTCAGGACTAC -3'
(R):5'- TCACTCGAATGAACTGAGAGC -3'

Sequencing Primer
(F):5'- GAGAGCTCAGGACTACAACATCTTAG -3'
(R):5'- TCGAATGAACTGAGAGCCCCAG -3'
Posted On 2018-09-12