Mutagenetix > Incidental Mutations

Incidental Mutation 'R6852:Sptlc3'

535001

Institutional Source

Beutler Lab

Gene Symbol

Sptlc3

Ensembl Gene

ENSMUSG00000039092

Gene Name

serine palmitoyltransferase, long chain base subunit 3

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.093) question?

Stock #

R6852 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

139493913-139637674 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 139566586 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 207 (I207T)

Ref Sequence

ENSEMBL: ENSMUSP00000105710 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047370] [ENSMUST00000110083]

AlphaFold

Q8BG54

Predicted Effect

probably benign
Transcript: ENSMUST00000047370
AA Change: I207T

PolyPhen 2 Score 0.435 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000048313
Gene: ENSMUSG00000039092
AA Change: I207T

Domain	Start	End	E-Value	Type
transmembrane domain	60	79	N/A	INTRINSIC
Pfam:Aminotran_1_2	160	520	4.8e-59	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000110083
AA Change: I207T

PolyPhen 2 Score 0.435 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000105710
Gene: ENSMUSG00000039092
AA Change: I207T

Domain	Start	End	E-Value	Type
transmembrane domain	60	79	N/A	INTRINSIC
Pfam:Aminotran_1_2	160	520	4.8e-59	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134801

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The SPTLC3 gene encodes an isoform of the third subunit of serine palmitoyltransferase (SPT; EC 2.3.1.50), which catalyzes the rate-limiting step of the de novo synthesis of sphingolipids (Hornemann et al., 2006 [PubMed 17023427]). SPT contains 2 main subunits: the common SPTLC1 subunit (MIM 605712) and either SPTLC2 (MIM 605713) or its isoform SPTLC2L (SPTLC3), depending on the tissue in which biosynthesis occurs (Hornemann et al., 2006 [PubMed 17023427]). There are also 2 highly related isoforms of a third subunit, SSSPTA (MIM 613540) and SSSPTB (MIM 610412), that confer acyl-CoA preference of the SPT enzyme and are essential for maximal enzyme activity (Han et al., 2009 [PubMed 19416851]).[supplied by OMIM, Nov 2010]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	C	T	3: 138,065,169	Q40*	probably null	Het
1700034E13Rik	T	C	18: 52,663,633	V81A	probably damaging	Het
2310035C23Rik	T	C	1: 105,753,595	L1184P	probably damaging	Het
5330417C22Rik	T	C	3: 108,482,338	E203G	probably damaging	Het
9530053A07Rik	T	A	7: 28,147,135	I1084N	probably damaging	Het
A630089N07Rik	A	G	16: 98,065,655	I369T	probably benign	Het
Aatk	T	A	11: 120,010,468	Q977L	probably benign	Het
Abca4	A	T	3: 122,135,195	Q144H	probably damaging	Het
Ampd3	T	C	7: 110,802,546	F416L	probably benign	Het
Anks1b	A	G	10: 90,260,654	E425G	probably damaging	Het
Atm	A	G	9: 53,482,430	S1737P	possibly damaging	Het
Bsph1	T	A	7: 13,470,330		probably null	Het
Cabyr	C	T	18: 12,754,097	P262S	probably benign	Het
Cdc14a	G	A	3: 116,328,676	P214L	possibly damaging	Het
Cep128	C	A	12: 91,366,342		probably null	Het
Cfh	T	A	1: 140,147,749	R250S	probably damaging	Het
Ddx39	T	C	8: 83,723,017	I417T	probably benign	Het
Dgka	T	A	10: 128,722,539	K548M	probably damaging	Het
Efr3a	G	A	15: 65,829,830	V198I	probably benign	Het
Epg5	C	T	18: 78,012,891	T1760I	probably damaging	Het
Fat1	T	C	8: 45,035,598	V3472A	possibly damaging	Het
Fbxo48	T	A	11: 16,953,402	N9K	probably benign	Het
Fer1l6	A	T	15: 58,594,878	H833L	probably damaging	Het
Foxn1	G	T	11: 78,360,960	Q482K	probably benign	Het
Fstl5	A	G	3: 76,707,855	D741G	probably damaging	Het
Gm8909	T	C	17: 36,168,073	N95D	possibly damaging	Het
Gmip	C	T	8: 69,817,991	Q55*	probably null	Het
Hapln2	G	A	3: 88,022,651	T306M	possibly damaging	Het
Kat6a	T	A	8: 22,938,660	S1344T	probably benign	Het
Kctd1	C	T	18: 14,986,344	D705N	possibly damaging	Het
Lhx9	ACC	ACCC	1: 138,841,806		probably null	Het
Micall2	G	T	5: 139,715,793	A482D	possibly damaging	Het
Mindy3	T	A	2: 12,419,252	M1L	possibly damaging	Het
Mtdh	A	G	15: 34,136,721	E352G	probably damaging	Het
Muc5ac	G	A	7: 141,816,907	V3219I	probably benign	Het
Myh4	A	G	11: 67,252,968		probably null	Het
Ncor1	A	G	11: 62,343,245	I377T	probably damaging	Het
Olfr1034	A	T	2: 86,046,604	I41F	probably benign	Het
Oog4	C	A	4: 143,439,109	C156F	possibly damaging	Het
Pcyt1a	T	C	16: 32,470,120	S260P	probably damaging	Het
Phf3	A	T	1: 30,804,630	F1749L	probably damaging	Het
Prickle2	T	C	6: 92,376,544	D647G	probably benign	Het
Raver2	T	C	4: 101,133,590	S387P	probably benign	Het
Rgs19	A	G	2: 181,689,148	S231P	possibly damaging	Het
Rpl8	G	T	15: 76,905,949	R198L	probably benign	Het
Sacs	T	A	14: 61,179,288	S77T	possibly damaging	Het
Samd14	G	A	11: 95,021,454	G219D	probably damaging	Het
Sec16a	C	T	2: 26,441,419	V195M	probably damaging	Het
Sesn2	C	T	4: 132,493,802	V453I	possibly damaging	Het
Slc46a3	A	T	5: 147,886,160	C291S	probably damaging	Het
Smarcal1	A	G	1: 72,591,173	T129A	possibly damaging	Het
Sorl1	T	A	9: 42,024,398	R1041W	possibly damaging	Het
Srgap3	T	C	6: 112,816,661	D118G	probably damaging	Het
Tas2r117	T	A	6: 132,802,929	V10D	probably benign	Het
Tbcd	A	G	11: 121,609,380	K1111E	probably benign	Het
Tor1aip1	A	T	1: 156,035,820	L139Q	probably damaging	Het
Trbv23	T	C	6: 41,216,247	V23A	probably damaging	Het
Ttll3	GGCAAAG	GGCAAAGCAAAG	6: 113,399,155		probably null	Het
Ttll3	CAAAGTAA	CAAAGTAAAGTAA	6: 113,399,157		probably null	Het
Ttll3	AAGTA	AAGTATAGTA	6: 113,399,159		probably null	Het
Vmn1r42	T	G	6: 89,844,787	T267P	possibly damaging	Het
Vmn2r53	C	A	7: 12,606,514	V11F	probably damaging	Het
Vmn2r67	T	C	7: 85,152,153	M192V	probably damaging	Het
Vmn2r78	T	C	7: 86,954,603	V663A	probably damaging	Het
Zdhhc1	C	T	8: 105,477,072	G156S	possibly damaging	Het
Zfp318	GAAGAA	GAAGAAAAAGAA	17: 46,412,533		probably benign	Het
Zfp318	AAGAAG	AAGAAGTAGAAG	17: 46,412,534		probably benign	Het
Zfp318	AGAAG	AGAAGAGGAAG	17: 46,412,538		probably benign	Het
Zfp560	A	G	9: 20,348,043	C508R	probably damaging	Het
Zfp654	G	A	16: 64,786,598	L414F	probably damaging	Het
Zfp872	A	T	9: 22,200,059	Y278F	probably damaging	Het
Zscan20	T	C	4: 128,589,722	S385G	probably damaging	Het

Other mutations in Sptlc3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01392:Sptlc3	APN	2	139546421	missense	possibly damaging	0.55
IGL01537:Sptlc3	APN	2	139589695	missense	possibly damaging	0.95
IGL01996:Sptlc3	APN	2	139581504	splice site	probably benign
IGL02512:Sptlc3	APN	2	139547203	missense	probably damaging	1.00
IGL03278:Sptlc3	APN	2	139589659	missense	probably damaging	1.00
IGL03286:Sptlc3	APN	2	139589659	missense	probably damaging	1.00
R0266:Sptlc3	UTSW	2	139596037	missense	possibly damaging	0.93
R0362:Sptlc3	UTSW	2	139546555	splice site	probably benign
R1464:Sptlc3	UTSW	2	139547234	missense	probably benign	0.00
R1464:Sptlc3	UTSW	2	139547234	missense	probably benign	0.00
R1494:Sptlc3	UTSW	2	139589560	missense	possibly damaging	0.58
R1847:Sptlc3	UTSW	2	139625923	missense	probably benign	0.08
R1919:Sptlc3	UTSW	2	139566675	missense	possibly damaging	0.66
R2093:Sptlc3	UTSW	2	139625874	missense	possibly damaging	0.89
R2396:Sptlc3	UTSW	2	139566586	missense	probably benign	0.44
R2972:Sptlc3	UTSW	2	139589661	missense	probably damaging	1.00
R2973:Sptlc3	UTSW	2	139589661	missense	probably damaging	1.00
R2974:Sptlc3	UTSW	2	139589661	missense	probably damaging	1.00
R4601:Sptlc3	UTSW	2	139636680	missense	probably benign	0.01
R4602:Sptlc3	UTSW	2	139636680	missense	probably benign	0.01
R4610:Sptlc3	UTSW	2	139636680	missense	probably benign	0.01
R4745:Sptlc3	UTSW	2	139547167	missense	probably damaging	1.00
R4779:Sptlc3	UTSW	2	139589589	missense	probably benign	0.04
R4992:Sptlc3	UTSW	2	139596003	missense	probably benign	0.04
R5162:Sptlc3	UTSW	2	139631343	missense	probably benign	0.11
R5401:Sptlc3	UTSW	2	139636723	missense	possibly damaging	0.75
R5406:Sptlc3	UTSW	2	139546478	missense	probably benign	0.26
R5642:Sptlc3	UTSW	2	139546408	missense	probably damaging	0.96
R5840:Sptlc3	UTSW	2	139547206	missense	probably damaging	1.00
R6057:Sptlc3	UTSW	2	139581613	missense	probably damaging	0.99
R6376:Sptlc3	UTSW	2	139636772	missense	probably benign	0.21
R7026:Sptlc3	UTSW	2	139537688	missense	probably benign
R7412:Sptlc3	UTSW	2	139589617	missense	possibly damaging	0.75
R7516:Sptlc3	UTSW	2	139589518	missense	probably benign	0.11
R7733:Sptlc3	UTSW	2	139631368	missense	possibly damaging	0.77
R7826:Sptlc3	UTSW	2	139547195	missense	probably benign	0.44
R7949:Sptlc3	UTSW	2	139625875	missense	possibly damaging	0.81
R9224:Sptlc3	UTSW	2	139494234	missense	probably benign	0.17
R9237:Sptlc3	UTSW	2	139566685	missense	probably benign	0.40
R9319:Sptlc3	UTSW	2	139636810	missense	possibly damaging	0.65
R9330:Sptlc3	UTSW	2	139546503	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ATAGGCTACATTCAACTGTGTTTCC -3'
(R):5'- TTGCCAACGCTTTTGATAAAGG -3'

Sequencing Primer
(F):5'- ggtctgtgttggtgtatg -3'
(R):5'- CTTGGGAGTGGTATAGCAG -3'

Posted On

2018-09-12