Incidental Mutation 'R6852:Slc46a3'
ID535014
Institutional Source Beutler Lab
Gene Symbol Slc46a3
Ensembl Gene ENSMUSG00000029650
Gene Namesolute carrier family 46, member 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6852 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location147878437-147894815 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 147886160 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 291 (C291S)
Ref Sequence ENSEMBL: ENSMUSP00000113879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031655] [ENSMUST00000118527]
Predicted Effect probably damaging
Transcript: ENSMUST00000031655
AA Change: C291S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031655
Gene: ENSMUSG00000029650
AA Change: C291S

DomainStartEndE-ValueType
Pfam:MFS_1 8 400 4.3e-15 PFAM
transmembrane domain 411 433 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118527
AA Change: C291S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113879
Gene: ENSMUSG00000029650
AA Change: C291S

DomainStartEndE-ValueType
Pfam:MFS_1 8 400 5.5e-15 PFAM
transmembrane domain 411 433 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a transmembrane protein family that transports small molecules across membranes. The encoded protein has been found in lysosomal membranes, where it can transport catabolites from the lysosomes to the cytoplasm. This protein has been shown to be an effective transporter of the cytotoxic drug maytansine, which is used in antibody-based targeting of cancer cells. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,065,169 Q40* probably null Het
1700034E13Rik T C 18: 52,663,633 V81A probably damaging Het
2310035C23Rik T C 1: 105,753,595 L1184P probably damaging Het
5330417C22Rik T C 3: 108,482,338 E203G probably damaging Het
9530053A07Rik T A 7: 28,147,135 I1084N probably damaging Het
A630089N07Rik A G 16: 98,065,655 I369T probably benign Het
Aatk T A 11: 120,010,468 Q977L probably benign Het
Abca4 A T 3: 122,135,195 Q144H probably damaging Het
Ampd3 T C 7: 110,802,546 F416L probably benign Het
Anks1b A G 10: 90,260,654 E425G probably damaging Het
Atm A G 9: 53,482,430 S1737P possibly damaging Het
Bsph1 T A 7: 13,470,330 probably null Het
Cabyr C T 18: 12,754,097 P262S probably benign Het
Cdc14a G A 3: 116,328,676 P214L possibly damaging Het
Cep128 C A 12: 91,366,342 probably null Het
Cfh T A 1: 140,147,749 R250S probably damaging Het
Ddx39 T C 8: 83,723,017 I417T probably benign Het
Dgka T A 10: 128,722,539 K548M probably damaging Het
Efr3a G A 15: 65,829,830 V198I probably benign Het
Epg5 C T 18: 78,012,891 T1760I probably damaging Het
Fat1 T C 8: 45,035,598 V3472A possibly damaging Het
Fbxo48 T A 11: 16,953,402 N9K probably benign Het
Fer1l6 A T 15: 58,594,878 H833L probably damaging Het
Foxn1 G T 11: 78,360,960 Q482K probably benign Het
Fstl5 A G 3: 76,707,855 D741G probably damaging Het
Gm8909 T C 17: 36,168,073 N95D possibly damaging Het
Gmip C T 8: 69,817,991 Q55* probably null Het
Hapln2 G A 3: 88,022,651 T306M possibly damaging Het
Kat6a T A 8: 22,938,660 S1344T probably benign Het
Kctd1 C T 18: 14,986,344 D705N possibly damaging Het
Lhx9 ACC ACCC 1: 138,841,806 probably null Het
Micall2 G T 5: 139,715,793 A482D possibly damaging Het
Mindy3 T A 2: 12,419,252 M1L possibly damaging Het
Mtdh A G 15: 34,136,721 E352G probably damaging Het
Muc5ac G A 7: 141,816,907 V3219I probably benign Het
Myh4 A G 11: 67,252,968 probably null Het
Ncor1 A G 11: 62,343,245 I377T probably damaging Het
Olfr1034 A T 2: 86,046,604 I41F probably benign Het
Oog4 C A 4: 143,439,109 C156F possibly damaging Het
Pcyt1a T C 16: 32,470,120 S260P probably damaging Het
Phf3 A T 1: 30,804,630 F1749L probably damaging Het
Prickle2 T C 6: 92,376,544 D647G probably benign Het
Raver2 T C 4: 101,133,590 S387P probably benign Het
Rgs19 A G 2: 181,689,148 S231P possibly damaging Het
Rpl8 G T 15: 76,905,949 R198L probably benign Het
Sacs T A 14: 61,179,288 S77T possibly damaging Het
Samd14 G A 11: 95,021,454 G219D probably damaging Het
Sec16a C T 2: 26,441,419 V195M probably damaging Het
Sesn2 C T 4: 132,493,802 V453I possibly damaging Het
Smarcal1 A G 1: 72,591,173 T129A possibly damaging Het
Sorl1 T A 9: 42,024,398 R1041W possibly damaging Het
Sptlc3 T C 2: 139,566,586 I207T probably benign Het
Srgap3 T C 6: 112,816,661 D118G probably damaging Het
Tas2r117 T A 6: 132,802,929 V10D probably benign Het
Tbcd A G 11: 121,609,380 K1111E probably benign Het
Tor1aip1 A T 1: 156,035,820 L139Q probably damaging Het
Trbv23 T C 6: 41,216,247 V23A probably damaging Het
Ttll3 GGCAAAG GGCAAAGCAAAG 6: 113,399,155 probably null Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Ttll3 AAGTA AAGTATAGTA 6: 113,399,159 probably null Het
Vmn1r42 T G 6: 89,844,787 T267P possibly damaging Het
Vmn2r53 C A 7: 12,606,514 V11F probably damaging Het
Vmn2r67 T C 7: 85,152,153 M192V probably damaging Het
Vmn2r78 T C 7: 86,954,603 V663A probably damaging Het
Zdhhc1 C T 8: 105,477,072 G156S possibly damaging Het
Zfp318 GAAGAA GAAGAAAAAGAA 17: 46,412,533 probably benign Het
Zfp318 AAGAAG AAGAAGTAGAAG 17: 46,412,534 probably benign Het
Zfp318 AGAAG AGAAGAGGAAG 17: 46,412,538 probably benign Het
Zfp560 A G 9: 20,348,043 C508R probably damaging Het
Zfp654 G A 16: 64,786,598 L414F probably damaging Het
Zfp872 A T 9: 22,200,059 Y278F probably damaging Het
Zscan20 T C 4: 128,589,722 S385G probably damaging Het
Other mutations in Slc46a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01701:Slc46a3 APN 5 147886298 missense probably benign 0.00
IGL02158:Slc46a3 APN 5 147886234 missense probably damaging 1.00
IGL02821:Slc46a3 APN 5 147886012 missense probably benign 0.00
R1990:Slc46a3 UTSW 5 147886594 missense probably damaging 1.00
R2125:Slc46a3 UTSW 5 147879144 missense probably benign 0.05
R3904:Slc46a3 UTSW 5 147886454 missense probably benign 0.21
R4619:Slc46a3 UTSW 5 147886730 nonsense probably null
R5151:Slc46a3 UTSW 5 147886756 missense probably damaging 1.00
R5740:Slc46a3 UTSW 5 147879833 nonsense probably null
R5843:Slc46a3 UTSW 5 147886211 missense probably benign
R5933:Slc46a3 UTSW 5 147893890 missense probably benign 0.03
R6453:Slc46a3 UTSW 5 147886390 missense possibly damaging 0.89
R6954:Slc46a3 UTSW 5 147886340 missense probably benign 0.01
Z1177:Slc46a3 UTSW 5 147886610 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CATTAGAGTGGTCCTGGTGAAG -3'
(R):5'- TTCCTCAATGATCCCATAAAGGAG -3'

Sequencing Primer
(F):5'- TCCTGGTGAAGGCAGCCAG -3'
(R):5'- AGGAGTCTTCATCTCAGATTGTGAC -3'
Posted On2018-09-12