Incidental Mutation 'R6852:Vmn2r78'
ID 535027
Institutional Source Beutler Lab
Gene Symbol Vmn2r78
Ensembl Gene ENSMUSG00000091962
Gene Name vomeronasal 2, receptor 78
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock # R6852 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 86915300-86955177 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 86954603 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 663 (V663A)
Ref Sequence ENSEMBL: ENSMUSP00000126698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170835]
AlphaFold K7N6U5
Predicted Effect probably damaging
Transcript: ENSMUST00000170835
AA Change: V663A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000126698
Gene: ENSMUSG00000091962
AA Change: V663A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 75 464 5.9e-31 PFAM
Pfam:NCD3G 507 559 8.1e-21 PFAM
Pfam:7tm_3 592 827 1e-52 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,065,169 Q40* probably null Het
1700034E13Rik T C 18: 52,663,633 V81A probably damaging Het
2310035C23Rik T C 1: 105,753,595 L1184P probably damaging Het
5330417C22Rik T C 3: 108,482,338 E203G probably damaging Het
9530053A07Rik T A 7: 28,147,135 I1084N probably damaging Het
A630089N07Rik A G 16: 98,065,655 I369T probably benign Het
Aatk T A 11: 120,010,468 Q977L probably benign Het
Abca4 A T 3: 122,135,195 Q144H probably damaging Het
Ampd3 T C 7: 110,802,546 F416L probably benign Het
Anks1b A G 10: 90,260,654 E425G probably damaging Het
Atm A G 9: 53,482,430 S1737P possibly damaging Het
Bsph1 T A 7: 13,470,330 probably null Het
Cabyr C T 18: 12,754,097 P262S probably benign Het
Cdc14a G A 3: 116,328,676 P214L possibly damaging Het
Cep128 C A 12: 91,366,342 probably null Het
Cfh T A 1: 140,147,749 R250S probably damaging Het
Ddx39 T C 8: 83,723,017 I417T probably benign Het
Dgka T A 10: 128,722,539 K548M probably damaging Het
Efr3a G A 15: 65,829,830 V198I probably benign Het
Epg5 C T 18: 78,012,891 T1760I probably damaging Het
Fat1 T C 8: 45,035,598 V3472A possibly damaging Het
Fbxo48 T A 11: 16,953,402 N9K probably benign Het
Fer1l6 A T 15: 58,594,878 H833L probably damaging Het
Foxn1 G T 11: 78,360,960 Q482K probably benign Het
Fstl5 A G 3: 76,707,855 D741G probably damaging Het
Gm8909 T C 17: 36,168,073 N95D possibly damaging Het
Gmip C T 8: 69,817,991 Q55* probably null Het
Hapln2 G A 3: 88,022,651 T306M possibly damaging Het
Kat6a T A 8: 22,938,660 S1344T probably benign Het
Kctd1 C T 18: 14,986,344 D705N possibly damaging Het
Lhx9 ACC ACCC 1: 138,841,806 probably null Het
Micall2 G T 5: 139,715,793 A482D possibly damaging Het
Mindy3 T A 2: 12,419,252 M1L possibly damaging Het
Mtdh A G 15: 34,136,721 E352G probably damaging Het
Muc5ac G A 7: 141,816,907 V3219I probably benign Het
Myh4 A G 11: 67,252,968 probably null Het
Ncor1 A G 11: 62,343,245 I377T probably damaging Het
Olfr1034 A T 2: 86,046,604 I41F probably benign Het
Oog4 C A 4: 143,439,109 C156F possibly damaging Het
Pcyt1a T C 16: 32,470,120 S260P probably damaging Het
Phf3 A T 1: 30,804,630 F1749L probably damaging Het
Prickle2 T C 6: 92,376,544 D647G probably benign Het
Raver2 T C 4: 101,133,590 S387P probably benign Het
Rgs19 A G 2: 181,689,148 S231P possibly damaging Het
Rpl8 G T 15: 76,905,949 R198L probably benign Het
Sacs T A 14: 61,179,288 S77T possibly damaging Het
Samd14 G A 11: 95,021,454 G219D probably damaging Het
Sec16a C T 2: 26,441,419 V195M probably damaging Het
Sesn2 C T 4: 132,493,802 V453I possibly damaging Het
Slc46a3 A T 5: 147,886,160 C291S probably damaging Het
Smarcal1 A G 1: 72,591,173 T129A possibly damaging Het
Sorl1 T A 9: 42,024,398 R1041W possibly damaging Het
Sptlc3 T C 2: 139,566,586 I207T probably benign Het
Srgap3 T C 6: 112,816,661 D118G probably damaging Het
Tas2r117 T A 6: 132,802,929 V10D probably benign Het
Tbcd A G 11: 121,609,380 K1111E probably benign Het
Tor1aip1 A T 1: 156,035,820 L139Q probably damaging Het
Trbv23 T C 6: 41,216,247 V23A probably damaging Het
Ttll3 GGCAAAG GGCAAAGCAAAG 6: 113,399,155 probably null Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Ttll3 AAGTA AAGTATAGTA 6: 113,399,159 probably null Het
Vmn1r42 T G 6: 89,844,787 T267P possibly damaging Het
Vmn2r53 C A 7: 12,606,514 V11F probably damaging Het
Vmn2r67 T C 7: 85,152,153 M192V probably damaging Het
Zdhhc1 C T 8: 105,477,072 G156S possibly damaging Het
Zfp318 GAAGAA GAAGAAAAAGAA 17: 46,412,533 probably benign Het
Zfp318 AAGAAG AAGAAGTAGAAG 17: 46,412,534 probably benign Het
Zfp318 AGAAG AGAAGAGGAAG 17: 46,412,538 probably benign Het
Zfp560 A G 9: 20,348,043 C508R probably damaging Het
Zfp654 G A 16: 64,786,598 L414F probably damaging Het
Zfp872 A T 9: 22,200,059 Y278F probably damaging Het
Zscan20 T C 4: 128,589,722 S385G probably damaging Het
Other mutations in Vmn2r78
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Vmn2r78 APN 7 86915361 missense unknown
IGL01473:Vmn2r78 APN 7 86920312 missense possibly damaging 0.61
IGL01767:Vmn2r78 APN 7 86954435 missense probably benign 0.28
IGL02322:Vmn2r78 APN 7 86921479 missense probably damaging 0.96
IGL02537:Vmn2r78 APN 7 86954288 missense probably damaging 0.99
IGL03297:Vmn2r78 APN 7 86920761 nonsense probably null
ANU74:Vmn2r78 UTSW 7 86921065 missense possibly damaging 0.62
R0035:Vmn2r78 UTSW 7 86920205 missense probably benign 0.22
R0081:Vmn2r78 UTSW 7 86923027 missense probably benign 0.35
R0401:Vmn2r78 UTSW 7 86921311 missense probably benign 0.04
R0751:Vmn2r78 UTSW 7 86954380 missense possibly damaging 0.77
R1341:Vmn2r78 UTSW 7 86922269 missense possibly damaging 0.71
R1386:Vmn2r78 UTSW 7 86915407 missense unknown
R1526:Vmn2r78 UTSW 7 86922257 splice site probably null
R1712:Vmn2r78 UTSW 7 86954924 missense probably damaging 1.00
R1739:Vmn2r78 UTSW 7 86920789 missense probably benign
R1812:Vmn2r78 UTSW 7 86920787 missense probably benign 0.38
R2011:Vmn2r78 UTSW 7 86955079 missense possibly damaging 0.52
R2144:Vmn2r78 UTSW 7 86954482 missense probably damaging 1.00
R2197:Vmn2r78 UTSW 7 86921327 missense probably damaging 0.96
R2291:Vmn2r78 UTSW 7 86920154 missense probably damaging 1.00
R2409:Vmn2r78 UTSW 7 86920745 splice site probably benign
R3023:Vmn2r78 UTSW 7 86954966 missense probably damaging 1.00
R4486:Vmn2r78 UTSW 7 86920751 critical splice acceptor site probably null
R4512:Vmn2r78 UTSW 7 86920244 missense probably benign 0.00
R4515:Vmn2r78 UTSW 7 86954258 missense probably damaging 0.99
R4544:Vmn2r78 UTSW 7 86921191 missense probably benign
R4546:Vmn2r78 UTSW 7 86954603 missense probably damaging 1.00
R4872:Vmn2r78 UTSW 7 86954708 missense possibly damaging 0.87
R4928:Vmn2r78 UTSW 7 86954627 missense probably damaging 1.00
R5101:Vmn2r78 UTSW 7 86922355 missense probably damaging 1.00
R5265:Vmn2r78 UTSW 7 86920124 missense probably damaging 1.00
R5328:Vmn2r78 UTSW 7 86921030 missense probably damaging 0.98
R5442:Vmn2r78 UTSW 7 86920122 missense possibly damaging 0.95
R5567:Vmn2r78 UTSW 7 86921529 missense probably benign 0.17
R5572:Vmn2r78 UTSW 7 86915512 missense probably benign 0.01
R5636:Vmn2r78 UTSW 7 86954429 missense probably damaging 0.99
R5901:Vmn2r78 UTSW 7 86954588 missense probably damaging 1.00
R5977:Vmn2r78 UTSW 7 86920333 missense possibly damaging 0.74
R5977:Vmn2r78 UTSW 7 86954907 missense probably benign 0.00
R6276:Vmn2r78 UTSW 7 86921110 missense probably benign 0.00
R6386:Vmn2r78 UTSW 7 86922337 nonsense probably null
R6724:Vmn2r78 UTSW 7 86954258 missense probably damaging 0.99
R6896:Vmn2r78 UTSW 7 86922350 missense probably benign 0.10
R7385:Vmn2r78 UTSW 7 86922425 missense probably benign 0.18
R7578:Vmn2r78 UTSW 7 86954344 nonsense probably null
R7680:Vmn2r78 UTSW 7 86954941 missense probably damaging 1.00
R7748:Vmn2r78 UTSW 7 86921135 missense probably benign 0.00
R7852:Vmn2r78 UTSW 7 86920170 nonsense probably null
R8031:Vmn2r78 UTSW 7 86954867 missense probably damaging 1.00
R8070:Vmn2r78 UTSW 7 86922487 missense probably benign 0.01
R8085:Vmn2r78 UTSW 7 86954790 missense probably benign 0.00
R8163:Vmn2r78 UTSW 7 86954452 missense probably damaging 1.00
R8501:Vmn2r78 UTSW 7 86920886 missense probably damaging 0.99
R8749:Vmn2r78 UTSW 7 86954305 missense possibly damaging 0.81
R9209:Vmn2r78 UTSW 7 86920223 missense probably benign 0.08
RF018:Vmn2r78 UTSW 7 86954431 nonsense probably null
Z1177:Vmn2r78 UTSW 7 86921207 missense probably benign 0.44
Z1177:Vmn2r78 UTSW 7 86954774 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GACACTCCCATAGTCAAGGC -3'
(R):5'- AGGCAGTCACTGAACCTTTG -3'

Sequencing Primer
(F):5'- GGCCAATAATGAAACTCTCAGCTATG -3'
(R):5'- CAGTCACTGAACCTTTGTTGCAAAC -3'
Posted On 2018-09-12