Incidental Mutation 'R6852:Vmn2r78'
ID535027
Institutional Source Beutler Lab
Gene Symbol Vmn2r78
Ensembl Gene ENSMUSG00000091962
Gene Namevomeronasal 2, receptor 78
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R6852 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location86915300-86955177 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86954603 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 663 (V663A)
Ref Sequence ENSEMBL: ENSMUSP00000126698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170835]
Predicted Effect probably damaging
Transcript: ENSMUST00000170835
AA Change: V663A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000126698
Gene: ENSMUSG00000091962
AA Change: V663A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 75 464 5.9e-31 PFAM
Pfam:NCD3G 507 559 8.1e-21 PFAM
Pfam:7tm_3 592 827 1e-52 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,065,169 Q40* probably null Het
1700034E13Rik T C 18: 52,663,633 V81A probably damaging Het
2310035C23Rik T C 1: 105,753,595 L1184P probably damaging Het
5330417C22Rik T C 3: 108,482,338 E203G probably damaging Het
9530053A07Rik T A 7: 28,147,135 I1084N probably damaging Het
A630089N07Rik A G 16: 98,065,655 I369T probably benign Het
Aatk T A 11: 120,010,468 Q977L probably benign Het
Abca4 A T 3: 122,135,195 Q144H probably damaging Het
Ampd3 T C 7: 110,802,546 F416L probably benign Het
Anks1b A G 10: 90,260,654 E425G probably damaging Het
Atm A G 9: 53,482,430 S1737P possibly damaging Het
Bsph1 T A 7: 13,470,330 probably null Het
Cabyr C T 18: 12,754,097 P262S probably benign Het
Cdc14a G A 3: 116,328,676 P214L possibly damaging Het
Cep128 C A 12: 91,366,342 probably null Het
Cfh T A 1: 140,147,749 R250S probably damaging Het
Ddx39 T C 8: 83,723,017 I417T probably benign Het
Dgka T A 10: 128,722,539 K548M probably damaging Het
Efr3a G A 15: 65,829,830 V198I probably benign Het
Epg5 C T 18: 78,012,891 T1760I probably damaging Het
Fat1 T C 8: 45,035,598 V3472A possibly damaging Het
Fbxo48 T A 11: 16,953,402 N9K probably benign Het
Fer1l6 A T 15: 58,594,878 H833L probably damaging Het
Foxn1 G T 11: 78,360,960 Q482K probably benign Het
Fstl5 A G 3: 76,707,855 D741G probably damaging Het
Gm8909 T C 17: 36,168,073 N95D possibly damaging Het
Gmip C T 8: 69,817,991 Q55* probably null Het
Hapln2 G A 3: 88,022,651 T306M possibly damaging Het
Kat6a T A 8: 22,938,660 S1344T probably benign Het
Kctd1 C T 18: 14,986,344 D705N possibly damaging Het
Lhx9 ACC ACCC 1: 138,841,806 probably null Het
Micall2 G T 5: 139,715,793 A482D possibly damaging Het
Mindy3 T A 2: 12,419,252 M1L possibly damaging Het
Mtdh A G 15: 34,136,721 E352G probably damaging Het
Muc5ac G A 7: 141,816,907 V3219I probably benign Het
Myh4 A G 11: 67,252,968 probably null Het
Ncor1 A G 11: 62,343,245 I377T probably damaging Het
Olfr1034 A T 2: 86,046,604 I41F probably benign Het
Oog4 C A 4: 143,439,109 C156F possibly damaging Het
Pcyt1a T C 16: 32,470,120 S260P probably damaging Het
Phf3 A T 1: 30,804,630 F1749L probably damaging Het
Prickle2 T C 6: 92,376,544 D647G probably benign Het
Raver2 T C 4: 101,133,590 S387P probably benign Het
Rgs19 A G 2: 181,689,148 S231P possibly damaging Het
Rpl8 G T 15: 76,905,949 R198L probably benign Het
Sacs T A 14: 61,179,288 S77T possibly damaging Het
Samd14 G A 11: 95,021,454 G219D probably damaging Het
Sec16a C T 2: 26,441,419 V195M probably damaging Het
Sesn2 C T 4: 132,493,802 V453I possibly damaging Het
Slc46a3 A T 5: 147,886,160 C291S probably damaging Het
Smarcal1 A G 1: 72,591,173 T129A possibly damaging Het
Sorl1 T A 9: 42,024,398 R1041W possibly damaging Het
Sptlc3 T C 2: 139,566,586 I207T probably benign Het
Srgap3 T C 6: 112,816,661 D118G probably damaging Het
Tas2r117 T A 6: 132,802,929 V10D probably benign Het
Tbcd A G 11: 121,609,380 K1111E probably benign Het
Tor1aip1 A T 1: 156,035,820 L139Q probably damaging Het
Trbv23 T C 6: 41,216,247 V23A probably damaging Het
Ttll3 GGCAAAG GGCAAAGCAAAG 6: 113,399,155 probably null Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Ttll3 AAGTA AAGTATAGTA 6: 113,399,159 probably null Het
Vmn1r42 T G 6: 89,844,787 T267P possibly damaging Het
Vmn2r53 C A 7: 12,606,514 V11F probably damaging Het
Vmn2r67 T C 7: 85,152,153 M192V probably damaging Het
Zdhhc1 C T 8: 105,477,072 G156S possibly damaging Het
Zfp318 GAAGAA GAAGAAAAAGAA 17: 46,412,533 probably benign Het
Zfp318 AAGAAG AAGAAGTAGAAG 17: 46,412,534 probably benign Het
Zfp318 AGAAG AGAAGAGGAAG 17: 46,412,538 probably benign Het
Zfp560 A G 9: 20,348,043 C508R probably damaging Het
Zfp654 G A 16: 64,786,598 L414F probably damaging Het
Zfp872 A T 9: 22,200,059 Y278F probably damaging Het
Zscan20 T C 4: 128,589,722 S385G probably damaging Het
Other mutations in Vmn2r78
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Vmn2r78 APN 7 86915361 missense unknown
IGL01473:Vmn2r78 APN 7 86920312 missense possibly damaging 0.61
IGL01767:Vmn2r78 APN 7 86954435 missense probably benign 0.28
IGL02322:Vmn2r78 APN 7 86921479 missense probably damaging 0.96
IGL02537:Vmn2r78 APN 7 86954288 missense probably damaging 0.99
IGL03297:Vmn2r78 APN 7 86920761 nonsense probably null
ANU74:Vmn2r78 UTSW 7 86921065 missense possibly damaging 0.62
R0035:Vmn2r78 UTSW 7 86920205 missense probably benign 0.22
R0081:Vmn2r78 UTSW 7 86923027 missense probably benign 0.35
R0401:Vmn2r78 UTSW 7 86921311 missense probably benign 0.04
R0751:Vmn2r78 UTSW 7 86954380 missense possibly damaging 0.77
R1341:Vmn2r78 UTSW 7 86922269 missense possibly damaging 0.71
R1386:Vmn2r78 UTSW 7 86915407 missense unknown
R1526:Vmn2r78 UTSW 7 86922257 splice site probably null
R1712:Vmn2r78 UTSW 7 86954924 missense probably damaging 1.00
R1739:Vmn2r78 UTSW 7 86920789 missense probably benign
R1812:Vmn2r78 UTSW 7 86920787 missense probably benign 0.38
R2011:Vmn2r78 UTSW 7 86955079 missense possibly damaging 0.52
R2144:Vmn2r78 UTSW 7 86954482 missense probably damaging 1.00
R2197:Vmn2r78 UTSW 7 86921327 missense probably damaging 0.96
R2291:Vmn2r78 UTSW 7 86920154 missense probably damaging 1.00
R2409:Vmn2r78 UTSW 7 86920745 splice site probably benign
R3023:Vmn2r78 UTSW 7 86954966 missense probably damaging 1.00
R4486:Vmn2r78 UTSW 7 86920751 critical splice acceptor site probably null
R4512:Vmn2r78 UTSW 7 86920244 missense probably benign 0.00
R4515:Vmn2r78 UTSW 7 86954258 missense probably damaging 0.99
R4544:Vmn2r78 UTSW 7 86921191 missense probably benign
R4546:Vmn2r78 UTSW 7 86954603 missense probably damaging 1.00
R4872:Vmn2r78 UTSW 7 86954708 missense possibly damaging 0.87
R4928:Vmn2r78 UTSW 7 86954627 missense probably damaging 1.00
R5101:Vmn2r78 UTSW 7 86922355 missense probably damaging 1.00
R5265:Vmn2r78 UTSW 7 86920124 missense probably damaging 1.00
R5328:Vmn2r78 UTSW 7 86921030 missense probably damaging 0.98
R5442:Vmn2r78 UTSW 7 86920122 missense possibly damaging 0.95
R5567:Vmn2r78 UTSW 7 86921529 missense probably benign 0.17
R5572:Vmn2r78 UTSW 7 86915512 missense probably benign 0.01
R5636:Vmn2r78 UTSW 7 86954429 missense probably damaging 0.99
R5901:Vmn2r78 UTSW 7 86954588 missense probably damaging 1.00
R5977:Vmn2r78 UTSW 7 86920333 missense possibly damaging 0.74
R5977:Vmn2r78 UTSW 7 86954907 missense probably benign 0.00
R6276:Vmn2r78 UTSW 7 86921110 missense probably benign 0.00
R6386:Vmn2r78 UTSW 7 86922337 nonsense probably null
R6724:Vmn2r78 UTSW 7 86954258 missense probably damaging 0.99
R6896:Vmn2r78 UTSW 7 86922350 missense probably benign 0.10
R7385:Vmn2r78 UTSW 7 86922425 missense probably benign 0.18
R7578:Vmn2r78 UTSW 7 86954344 nonsense probably null
R7680:Vmn2r78 UTSW 7 86954941 missense probably damaging 1.00
R7748:Vmn2r78 UTSW 7 86921135 missense probably benign 0.00
R7852:Vmn2r78 UTSW 7 86920170 nonsense probably null
R7935:Vmn2r78 UTSW 7 86920170 nonsense probably null
R8031:Vmn2r78 UTSW 7 86954867 missense probably damaging 1.00
R8070:Vmn2r78 UTSW 7 86922487 missense probably benign 0.01
R8085:Vmn2r78 UTSW 7 86954790 missense probably benign 0.00
R8163:Vmn2r78 UTSW 7 86954452 missense probably damaging 1.00
RF018:Vmn2r78 UTSW 7 86954431 nonsense probably null
Z1177:Vmn2r78 UTSW 7 86921207 missense probably benign 0.44
Z1177:Vmn2r78 UTSW 7 86954774 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GACACTCCCATAGTCAAGGC -3'
(R):5'- AGGCAGTCACTGAACCTTTG -3'

Sequencing Primer
(F):5'- GGCCAATAATGAAACTCTCAGCTATG -3'
(R):5'- CAGTCACTGAACCTTTGTTGCAAAC -3'
Posted On2018-09-12