Incidental Mutation 'R6852:Gmip'
ID535032
Institutional Source Beutler Lab
Gene Symbol Gmip
Ensembl Gene ENSMUSG00000036246
Gene NameGem-interacting protein
Synonyms5031419I10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.198) question?
Stock #R6852 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location69808679-69821870 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 69817991 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 55 (Q55*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034325] [ENSMUST00000036074] [ENSMUST00000123453] [ENSMUST00000164890]
Predicted Effect probably benign
Transcript: ENSMUST00000034325
SMART Domains Protein: ENSMUSP00000034325
Gene: ENSMUSG00000031861

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 40 307 8.1e-10 PFAM
Pfam:7tm_1 46 292 5.1e-36 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000036074
AA Change: Q784*
SMART Domains Protein: ENSMUSP00000045676
Gene: ENSMUSG00000036246
AA Change: Q784*

DomainStartEndE-ValueType
PDB:3QWE|A 85 356 1e-149 PDB
low complexity region 358 367 N/A INTRINSIC
low complexity region 389 406 N/A INTRINSIC
low complexity region 419 431 N/A INTRINSIC
C1 491 536 1.75e-6 SMART
RhoGAP 561 753 1.06e-61 SMART
Blast:RhoGAP 824 971 1e-53 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000123453
AA Change: Q784*
SMART Domains Protein: ENSMUSP00000116542
Gene: ENSMUSG00000036246
AA Change: Q784*

DomainStartEndE-ValueType
PDB:3QWE|A 85 356 1e-150 PDB
low complexity region 358 367 N/A INTRINSIC
low complexity region 389 406 N/A INTRINSIC
low complexity region 419 431 N/A INTRINSIC
C1 491 536 1.75e-6 SMART
RhoGAP 561 753 1.06e-61 SMART
Predicted Effect probably null
Transcript: ENSMUST00000142659
AA Change: Q55*
SMART Domains Protein: ENSMUSP00000114525
Gene: ENSMUSG00000036246
AA Change: Q55*

DomainStartEndE-ValueType
Blast:RhoGAP 2 25 1e-7 BLAST
SCOP:d1f7ca_ 3 32 7e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164890
SMART Domains Protein: ENSMUSP00000128261
Gene: ENSMUSG00000031861

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 40 307 8.1e-10 PFAM
Pfam:7tm_1 46 292 1.1e-32 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ARHGAP family of Rho/Rac/Cdc42-like GTPase activating proteins. The encoded protein interacts with the Ras-related protein Gem through its N-terminal domain. Separately, it interacts with RhoA through a RhoGAP domain, and stimulates RhoA-dependent GTPase activity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,065,169 Q40* probably null Het
1700034E13Rik T C 18: 52,663,633 V81A probably damaging Het
2310035C23Rik T C 1: 105,753,595 L1184P probably damaging Het
5330417C22Rik T C 3: 108,482,338 E203G probably damaging Het
9530053A07Rik T A 7: 28,147,135 I1084N probably damaging Het
A630089N07Rik A G 16: 98,065,655 I369T probably benign Het
Aatk T A 11: 120,010,468 Q977L probably benign Het
Abca4 A T 3: 122,135,195 Q144H probably damaging Het
Ampd3 T C 7: 110,802,546 F416L probably benign Het
Anks1b A G 10: 90,260,654 E425G probably damaging Het
Atm A G 9: 53,482,430 S1737P possibly damaging Het
Bsph1 T A 7: 13,470,330 probably null Het
Cabyr C T 18: 12,754,097 P262S probably benign Het
Cdc14a G A 3: 116,328,676 P214L possibly damaging Het
Cep128 C A 12: 91,366,342 probably null Het
Cfh T A 1: 140,147,749 R250S probably damaging Het
Ddx39 T C 8: 83,723,017 I417T probably benign Het
Dgka T A 10: 128,722,539 K548M probably damaging Het
Efr3a G A 15: 65,829,830 V198I probably benign Het
Epg5 C T 18: 78,012,891 T1760I probably damaging Het
Fat1 T C 8: 45,035,598 V3472A possibly damaging Het
Fbxo48 T A 11: 16,953,402 N9K probably benign Het
Fer1l6 A T 15: 58,594,878 H833L probably damaging Het
Foxn1 G T 11: 78,360,960 Q482K probably benign Het
Fstl5 A G 3: 76,707,855 D741G probably damaging Het
Gm8909 T C 17: 36,168,073 N95D possibly damaging Het
Hapln2 G A 3: 88,022,651 T306M possibly damaging Het
Kat6a T A 8: 22,938,660 S1344T probably benign Het
Kctd1 C T 18: 14,986,344 D705N possibly damaging Het
Lhx9 ACC ACCC 1: 138,841,806 probably null Het
Micall2 G T 5: 139,715,793 A482D possibly damaging Het
Mindy3 T A 2: 12,419,252 M1L possibly damaging Het
Mtdh A G 15: 34,136,721 E352G probably damaging Het
Muc5ac G A 7: 141,816,907 V3219I probably benign Het
Myh4 A G 11: 67,252,968 probably null Het
Ncor1 A G 11: 62,343,245 I377T probably damaging Het
Olfr1034 A T 2: 86,046,604 I41F probably benign Het
Oog4 C A 4: 143,439,109 C156F possibly damaging Het
Pcyt1a T C 16: 32,470,120 S260P probably damaging Het
Phf3 A T 1: 30,804,630 F1749L probably damaging Het
Prickle2 T C 6: 92,376,544 D647G probably benign Het
Raver2 T C 4: 101,133,590 S387P probably benign Het
Rgs19 A G 2: 181,689,148 S231P possibly damaging Het
Rpl8 G T 15: 76,905,949 R198L probably benign Het
Sacs T A 14: 61,179,288 S77T possibly damaging Het
Samd14 G A 11: 95,021,454 G219D probably damaging Het
Sec16a C T 2: 26,441,419 V195M probably damaging Het
Sesn2 C T 4: 132,493,802 V453I possibly damaging Het
Slc46a3 A T 5: 147,886,160 C291S probably damaging Het
Smarcal1 A G 1: 72,591,173 T129A possibly damaging Het
Sorl1 T A 9: 42,024,398 R1041W possibly damaging Het
Sptlc3 T C 2: 139,566,586 I207T probably benign Het
Srgap3 T C 6: 112,816,661 D118G probably damaging Het
Tas2r117 T A 6: 132,802,929 V10D probably benign Het
Tbcd A G 11: 121,609,380 K1111E probably benign Het
Tor1aip1 A T 1: 156,035,820 L139Q probably damaging Het
Trbv23 T C 6: 41,216,247 V23A probably damaging Het
Ttll3 GGCAAAG GGCAAAGCAAAG 6: 113,399,155 probably null Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Ttll3 AAGTA AAGTATAGTA 6: 113,399,159 probably null Het
Vmn1r42 T G 6: 89,844,787 T267P possibly damaging Het
Vmn2r53 C A 7: 12,606,514 V11F probably damaging Het
Vmn2r67 T C 7: 85,152,153 M192V probably damaging Het
Vmn2r78 T C 7: 86,954,603 V663A probably damaging Het
Zdhhc1 C T 8: 105,477,072 G156S possibly damaging Het
Zfp318 GAAGAA GAAGAAAAAGAA 17: 46,412,533 probably benign Het
Zfp318 AAGAAG AAGAAGTAGAAG 17: 46,412,534 probably benign Het
Zfp318 AGAAG AGAAGAGGAAG 17: 46,412,538 probably benign Het
Zfp560 A G 9: 20,348,043 C508R probably damaging Het
Zfp654 G A 16: 64,786,598 L414F probably damaging Het
Zfp872 A T 9: 22,200,059 Y278F probably damaging Het
Zscan20 T C 4: 128,589,722 S385G probably damaging Het
Other mutations in Gmip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Gmip APN 8 69817011 nonsense probably null
IGL02529:Gmip APN 8 69816789 missense probably damaging 0.99
IGL03185:Gmip APN 8 69809783 missense probably benign 0.02
IGL03328:Gmip APN 8 69811611 missense possibly damaging 0.79
microdot UTSW 8 69814135 missense probably damaging 1.00
minnox UTSW 8 69817802 missense probably benign 0.02
puncta UTSW 8 69816086 missense possibly damaging 0.50
R0110:Gmip UTSW 8 69815609 unclassified probably benign
R0329:Gmip UTSW 8 69810818 missense probably benign 0.06
R0330:Gmip UTSW 8 69810818 missense probably benign 0.06
R0510:Gmip UTSW 8 69815609 unclassified probably benign
R0638:Gmip UTSW 8 69811445 splice site probably benign
R1692:Gmip UTSW 8 69813903 missense probably benign
R1721:Gmip UTSW 8 69811232 missense probably damaging 0.96
R1755:Gmip UTSW 8 69814124 missense probably damaging 1.00
R1801:Gmip UTSW 8 69814477 missense probably benign
R1894:Gmip UTSW 8 69820972 missense probably damaging 1.00
R1926:Gmip UTSW 8 69815520 missense probably benign 0.41
R2005:Gmip UTSW 8 69814043 missense probably benign
R4280:Gmip UTSW 8 69813601 unclassified probably benign
R4281:Gmip UTSW 8 69813601 unclassified probably benign
R4282:Gmip UTSW 8 69813601 unclassified probably benign
R4283:Gmip UTSW 8 69813601 unclassified probably benign
R5221:Gmip UTSW 8 69814135 missense probably damaging 1.00
R5512:Gmip UTSW 8 69817890 missense probably benign 0.00
R5521:Gmip UTSW 8 69817399 missense probably damaging 1.00
R5763:Gmip UTSW 8 69817851 missense probably damaging 1.00
R6151:Gmip UTSW 8 69817085 missense probably damaging 1.00
R6163:Gmip UTSW 8 69817372 missense probably benign 0.28
R6228:Gmip UTSW 8 69816123 missense probably damaging 1.00
R6775:Gmip UTSW 8 69815635 missense possibly damaging 0.82
R6787:Gmip UTSW 8 69813786 missense probably damaging 1.00
R6788:Gmip UTSW 8 69811174 missense possibly damaging 0.87
R6788:Gmip UTSW 8 69811176 missense probably damaging 1.00
R6934:Gmip UTSW 8 69820926 missense probably benign
R7010:Gmip UTSW 8 69811400 missense probably damaging 1.00
R7122:Gmip UTSW 8 69817802 missense probably benign 0.02
R7254:Gmip UTSW 8 69816468 intron probably null
R7351:Gmip UTSW 8 69817384 missense probably benign 0.01
R7360:Gmip UTSW 8 69811242 missense probably damaging 1.00
R7412:Gmip UTSW 8 69820499 missense probably benign
R7577:Gmip UTSW 8 69814435 missense probably benign 0.17
R7718:Gmip UTSW 8 69817733 missense probably damaging 0.99
R8018:Gmip UTSW 8 69815493 missense probably benign 0.41
R8080:Gmip UTSW 8 69816086 missense possibly damaging 0.50
X0063:Gmip UTSW 8 69809816 missense probably damaging 1.00
Z1176:Gmip UTSW 8 69816292 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTTGGGCCTACACTGCTGC -3'
(R):5'- ATGCGTGTGCCTGCATACTC -3'

Sequencing Primer
(F):5'- TACACTGCTGCGGCCAC -3'
(R):5'- AGCCCTGGAGTCAATATCCAGTTG -3'
Posted On2018-09-12