Mutagenetix > Incidental Mutation

Incidental Mutation 'R6853:Sis'

535077

Institutional Source

Beutler Lab

Gene Symbol

Sis

Ensembl Gene

ENSMUSG00000027790

Gene Name

sucrase isomaltase (alpha-glucosidase)

Synonyms

Si-s, sucrase-isomaltase

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6853 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

72888557-72967863 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 72891426 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 1763 (I1763T)

Ref Sequence

ENSEMBL: ENSMUSP00000129116 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094190] [ENSMUST00000167334]

AlphaFold

F8VQM5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000094190
AA Change: I1763T

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000091742
Gene: ENSMUSG00000027790
AA Change: I1763T

Domain	Start	End	E-Value	Type
transmembrane domain	13	32	N/A	INTRINSIC
PD	51	103	1.92e-12	SMART
Pfam:NtCtMGAM_N	115	224	1.2e-35	PFAM
Pfam:Gal_mutarotas_2	225	294	4.8e-9	PFAM
Pfam:Glyco_hydro_31	314	787	2.1e-142	PFAM
PD	917	972	6.69e-12	SMART
Pfam:NtCtMGAM_N	985	1098	6e-33	PFAM
Blast:ANK	1138	1168	1e-5	BLAST
Pfam:Glyco_hydro_31	1186	1682	8.4e-137	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000167334
AA Change: I1763T

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000129116
Gene: ENSMUSG00000027790
AA Change: I1763T

Domain	Start	End	E-Value	Type
transmembrane domain	13	32	N/A	INTRINSIC
PD	51	103	1.92e-12	SMART
Pfam:NtCtMGAM_N	115	224	1.2e-35	PFAM
Pfam:Gal_mutarotas_2	225	294	4.8e-9	PFAM
Pfam:Glyco_hydro_31	314	787	2.1e-142	PFAM
PD	917	972	6.69e-12	SMART
Pfam:NtCtMGAM_N	985	1098	6e-33	PFAM
Blast:ANK	1138	1168	1e-5	BLAST
Pfam:Glyco_hydro_31	1186	1682	8.4e-137	PFAM

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.0%

Validation Efficiency

98% (63/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sucrase-isomaltase enzyme that is expressed in the intestinal brush border. The encoded protein is synthesized as a precursor protein that is cleaved by pancreatic proteases into two enzymatic subunits sucrase and isomaltase. These two subunits heterodimerize to form the sucrose-isomaltase complex. This complex is essential for the digestion of dietary carbohydrates including starch, sucrose and isomaltose. Mutations in this gene are the cause of congenital sucrase-isomaltase deficiency.[provided by RefSeq, Apr 2010]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6030458C11Rik	G	T	15: 12,817,945	D138E	probably benign	Het
Atp13a5	A	G	16: 29,321,662	S359P	possibly damaging	Het
Bcam	T	C	7: 19,760,406	D355G	probably damaging	Het
Bmp8a	C	A	4: 123,342,683	W9L	unknown	Het
Cacul1	A	T	19: 60,529,466	Y334*	probably null	Het
Ccdc178	A	T	18: 22,109,876	N227K	probably benign	Het
Ceacam2	T	C	7: 25,518,136	N318S	possibly damaging	Het
Cntrl	T	A	2: 35,129,821	S553R	possibly damaging	Het
Ctsa	T	A	2: 164,837,364	M331K	probably benign	Het
Cyp2c38	T	A	19: 39,438,304	Q184H	probably benign	Het
Cyp2c70	C	T	19: 40,183,920	E93K	possibly damaging	Het
D430041D05Rik	C	T	2: 104,241,155	V1267M	probably damaging	Het
Ddias	C	T	7: 92,859,565	A381T	possibly damaging	Het
Dnhd1	G	A	7: 105,703,728	C2696Y	probably benign	Het
Efr3a	G	A	15: 65,829,830	V198I	probably benign	Het
Farp2	T	C	1: 93,570,016	F256S	probably damaging	Het
Fga	A	G	3: 83,030,912	Y198C	probably damaging	Het
Gabpa	T	A	16: 84,860,499	C421S	probably damaging	Het
Gm21798	A	T	15: 64,817,865		probably benign	Het
Gm21798	A	T	15: 64,817,867		probably benign	Het
Gm7145	A	C	1: 117,986,144	N252T	possibly damaging	Het
H2-Q6	T	C	17: 35,428,359	*327R	probably null	Het
H6pd	T	C	4: 149,982,462	D489G	probably benign	Het
Htra2	A	G	6: 83,053,831		probably benign	Het
Ice1	T	G	13: 70,603,302	E1555A	possibly damaging	Het
Inpp5d	T	A	1: 87,681,680		probably null	Het
Itih2	T	C	2: 10,115,266	D320G	probably damaging	Het
Kif1a	T	G	1: 93,039,802	H1129P	possibly damaging	Het
Kmt2a	G	A	9: 44,818,407		probably benign	Het
L3mbtl4	G	A	17: 68,777,920	D609N	probably damaging	Het
Lgals9	A	T	11: 78,966,006	D248E	probably benign	Het
Lhx9	ACC	ACCC	1: 138,841,806		probably null	Het
Msh3	A	G	13: 92,312,572		probably null	Het
Mtus2	A	G	5: 148,107,011	K803R	probably damaging	Het
Oas1a	T	A	5: 120,907,428	I17L	possibly damaging	Het
Olfr1480	T	A	19: 13,529,931	I130K	possibly damaging	Het
Olfr178	C	T	16: 58,889,758	S154N	possibly damaging	Het
Olfr178	T	A	16: 58,889,759	S154C	probably damaging	Het
Olfr851	T	G	9: 19,496,806	Y19*	probably null	Het
Olfr92	G	A	17: 37,111,508	T158I	probably benign	Het
Otof	T	C	5: 30,388,239	D539G	probably damaging	Het
Pabpc4	T	C	4: 123,294,743	Y382H	possibly damaging	Het
Rag1	T	C	2: 101,642,221	T859A	probably damaging	Het
Ralbp1	C	T	17: 65,852,756	R504H	possibly damaging	Het
Sdk2	A	G	11: 113,780,929	F2131S	probably damaging	Het
Sik1	A	T	17: 31,854,206		probably null	Het
Slc39a6	A	G	18: 24,599,319	I304T	possibly damaging	Het
Slc5a12	A	G	2: 110,624,194	S367G	probably benign	Het
Smchd1	A	T	17: 71,436,743	W476R	probably damaging	Het
Spag17	T	C	3: 100,013,235	Y429H	possibly damaging	Het
Stt3a	G	A	9: 36,741,727	S553F	possibly damaging	Het
Sult2a1	C	T	7: 13,801,487	V214I	possibly damaging	Het
Supt6	T	C	11: 78,232,830	E38G	possibly damaging	Het
Tenm4	G	A	7: 96,837,295	G990R	possibly damaging	Het
Thop1	T	C	10: 81,075,661		probably null	Het
Thumpd2	C	A	17: 81,065,030	D11Y	possibly damaging	Het
Tmf1	T	G	6: 97,168,849	I574L	probably damaging	Het
Tnfaip3	A	G	10: 19,003,751	V623A	probably benign	Het
Ttll3	CAAAGTAA	CAAAGTAAAGTAA	6: 113,399,157		probably null	Het
Ush2a	T	G	1: 188,911,237	Y4265*	probably null	Het
Vamp5	G	A	6: 72,380,441		probably benign	Het
Vmn2r12	A	T	5: 109,092,905	L114Q	probably damaging	Het
Vmn2r98	A	T	17: 19,065,801	Y187F	probably benign	Het

Other mutations in Sis

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00582:Sis	APN	3	72946636	missense	probably benign
IGL00715:Sis	APN	3	72934124	missense	probably damaging	1.00
IGL00721:Sis	APN	3	72943579	missense	probably damaging	1.00
IGL00766:Sis	APN	3	72907237	splice site	probably benign
IGL00783:Sis	APN	3	72946632	missense	probably benign
IGL00805:Sis	APN	3	72934199	missense	probably benign	0.05
IGL00932:Sis	APN	3	72940956	splice site	probably benign
IGL01020:Sis	APN	3	72966838	missense	probably damaging	1.00
IGL01024:Sis	APN	3	72911876	missense	probably damaging	1.00
IGL01286:Sis	APN	3	72941025	missense	probably damaging	1.00
IGL01457:Sis	APN	3	72961021	missense	probably benign
IGL01514:Sis	APN	3	72935920	splice site	probably benign
IGL01986:Sis	APN	3	72945212	missense	probably damaging	1.00
IGL02110:Sis	APN	3	72928699	nonsense	probably null
IGL02132:Sis	APN	3	72947471	missense	probably benign	0.00
IGL02152:Sis	APN	3	72888986	utr 3 prime	probably benign
IGL02200:Sis	APN	3	72943604	missense	probably damaging	0.99
IGL02244:Sis	APN	3	72956190	missense	probably benign	0.19
IGL02307:Sis	APN	3	72911834	splice site	probably benign
IGL02374:Sis	APN	3	72925456	missense	probably benign	0.03
IGL02437:Sis	APN	3	72919614	critical splice acceptor site	probably null
IGL02571:Sis	APN	3	72956304	splice site	probably benign
IGL02601:Sis	APN	3	72913210	missense	probably benign	0.44
IGL03063:Sis	APN	3	72928297	missense	probably benign
IGL03382:Sis	APN	3	72928719	missense	probably benign	0.00
IGL03397:Sis	APN	3	72935879	missense	probably benign	0.44
PIT1430001:Sis	UTSW	3	72922829	missense	probably damaging	0.97
R0013:Sis	UTSW	3	72910476	missense	possibly damaging	0.65
R0013:Sis	UTSW	3	72910476	missense	possibly damaging	0.65
R0046:Sis	UTSW	3	72932094	missense	probably benign	0.01
R0094:Sis	UTSW	3	72921437	missense	probably damaging	1.00
R0096:Sis	UTSW	3	72928267	missense	probably damaging	1.00
R0505:Sis	UTSW	3	72960296	missense	probably benign	0.29
R0544:Sis	UTSW	3	72951642	missense	probably damaging	1.00
R0551:Sis	UTSW	3	72925407	missense	possibly damaging	0.79
R0617:Sis	UTSW	3	72965605	missense	probably damaging	1.00
R0698:Sis	UTSW	3	72910498	missense	probably damaging	1.00
R0701:Sis	UTSW	3	72941045	missense	probably damaging	1.00
R0704:Sis	UTSW	3	72949822	missense	possibly damaging	0.63
R0706:Sis	UTSW	3	72952531	missense	probably damaging	1.00
R0710:Sis	UTSW	3	72952531	missense	probably damaging	1.00
R0752:Sis	UTSW	3	72952531	missense	probably damaging	1.00
R0753:Sis	UTSW	3	72952531	missense	probably damaging	1.00
R0754:Sis	UTSW	3	72952531	missense	probably damaging	1.00
R0767:Sis	UTSW	3	72952531	missense	probably damaging	1.00
R0769:Sis	UTSW	3	72952531	missense	probably damaging	1.00
R0772:Sis	UTSW	3	72952531	missense	probably damaging	1.00
R0774:Sis	UTSW	3	72952531	missense	probably damaging	1.00
R0776:Sis	UTSW	3	72952531	missense	probably damaging	1.00
R0818:Sis	UTSW	3	72952531	missense	probably damaging	1.00
R0819:Sis	UTSW	3	72952531	missense	probably damaging	1.00
R0885:Sis	UTSW	3	72911949	nonsense	probably null
R1076:Sis	UTSW	3	72934098	missense	probably damaging	0.97
R1140:Sis	UTSW	3	72951616	missense	probably damaging	0.98
R1175:Sis	UTSW	3	72958104	splice site	probably benign
R1301:Sis	UTSW	3	72946582	missense	possibly damaging	0.76
R1437:Sis	UTSW	3	72934142	missense	probably damaging	1.00
R1466:Sis	UTSW	3	72932060	missense	possibly damaging	0.60
R1466:Sis	UTSW	3	72932060	missense	possibly damaging	0.60
R1472:Sis	UTSW	3	72889027	missense	probably benign	0.12
R1584:Sis	UTSW	3	72932060	missense	possibly damaging	0.60
R1707:Sis	UTSW	3	72909087	splice site	probably benign
R1715:Sis	UTSW	3	72889010	missense	possibly damaging	0.47
R1719:Sis	UTSW	3	72965604	missense	probably damaging	1.00
R1728:Sis	UTSW	3	72965645	nonsense	probably null
R1784:Sis	UTSW	3	72965645	nonsense	probably null
R1820:Sis	UTSW	3	72921142	missense	probably damaging	1.00
R1972:Sis	UTSW	3	72921004	missense	probably damaging	1.00
R1973:Sis	UTSW	3	72921004	missense	probably damaging	1.00
R2054:Sis	UTSW	3	72913237	missense	probably benign	0.01
R2233:Sis	UTSW	3	72913194	missense	probably benign	0.03
R2235:Sis	UTSW	3	72913194	missense	probably benign	0.03
R2276:Sis	UTSW	3	72914601	nonsense	probably null
R2435:Sis	UTSW	3	72911904	missense	probably benign	0.01
R2885:Sis	UTSW	3	72909173	missense	probably benign	0.01
R2966:Sis	UTSW	3	72889010	missense	probably benign	0.30
R3708:Sis	UTSW	3	72943523	missense	probably benign	0.02
R3790:Sis	UTSW	3	72921414	missense	probably damaging	1.00
R3807:Sis	UTSW	3	72925596	missense	probably benign	0.01
R3858:Sis	UTSW	3	72928652	missense	probably damaging	0.99
R3974:Sis	UTSW	3	72943635	missense	probably damaging	0.96
R3975:Sis	UTSW	3	72943635	missense	probably damaging	0.96
R4037:Sis	UTSW	3	72928602	missense	probably benign
R4080:Sis	UTSW	3	72921184	missense	probably damaging	1.00
R4204:Sis	UTSW	3	72961082	missense	probably benign
R4394:Sis	UTSW	3	72956149	missense	probably damaging	1.00
R4470:Sis	UTSW	3	72928159	splice site	probably null
R4573:Sis	UTSW	3	72928237	missense	possibly damaging	0.94
R4868:Sis	UTSW	3	72943548	missense	probably benign	0.09
R5023:Sis	UTSW	3	72934122	missense	probably benign	0.05
R5264:Sis	UTSW	3	72949756	missense	probably damaging	0.98
R5414:Sis	UTSW	3	72952493	missense	probably benign
R5462:Sis	UTSW	3	72949838	missense	probably damaging	0.96
R5523:Sis	UTSW	3	72891421	missense	probably benign	0.00
R5584:Sis	UTSW	3	72910415	missense	probably damaging	1.00
R5587:Sis	UTSW	3	72914576	missense	possibly damaging	0.94
R5725:Sis	UTSW	3	72965598	missense	probably damaging	1.00
R5769:Sis	UTSW	3	72928235	missense	probably damaging	0.98
R5790:Sis	UTSW	3	72928174	missense	probably benign
R5864:Sis	UTSW	3	72949818	missense	probably damaging	1.00
R5902:Sis	UTSW	3	72960256	critical splice donor site	probably null
R5925:Sis	UTSW	3	72921380	splice site	probably null
R6018:Sis	UTSW	3	72913192	missense	possibly damaging	0.95
R6029:Sis	UTSW	3	72928308	missense	probably benign	0.30
R6124:Sis	UTSW	3	72953211	missense	possibly damaging	0.69
R6171:Sis	UTSW	3	72961027	missense	possibly damaging	0.75
R6182:Sis	UTSW	3	72904293	missense	probably benign	0.05
R6295:Sis	UTSW	3	72966770	missense	probably damaging	0.99
R6416:Sis	UTSW	3	72911854	missense	probably damaging	1.00
R6431:Sis	UTSW	3	72958174	missense	probably benign	0.00
R6472:Sis	UTSW	3	72938734	nonsense	probably null
R6517:Sis	UTSW	3	72907142	missense	probably damaging	1.00
R6701:Sis	UTSW	3	72949527	missense	probably damaging	1.00
R6796:Sis	UTSW	3	72965618	missense	probably benign	0.06
R6906:Sis	UTSW	3	72919485	missense	probably damaging	1.00
R7058:Sis	UTSW	3	72903607	missense	probably damaging	0.98
R7357:Sis	UTSW	3	72925071	missense	probably damaging	1.00
R7381:Sis	UTSW	3	72913292	splice site	probably null
R7439:Sis	UTSW	3	72909041	missense	possibly damaging	0.81
R7742:Sis	UTSW	3	72925098	missense	probably benign	0.19
R7813:Sis	UTSW	3	72925468	missense	probably benign	0.01
R7883:Sis	UTSW	3	72920996	missense	possibly damaging	0.78
R7899:Sis	UTSW	3	72937251	missense	probably damaging	1.00
R7915:Sis	UTSW	3	72921138	missense	probably damaging	0.99
R7985:Sis	UTSW	3	72936961	splice site	probably null
R8020:Sis	UTSW	3	72908965	critical splice donor site	probably null
R8023:Sis	UTSW	3	72952480	missense	probably damaging	0.97
R8029:Sis	UTSW	3	72921142	missense	probably damaging	1.00
R8053:Sis	UTSW	3	72949568	nonsense	probably null
R8062:Sis	UTSW	3	72920988	nonsense	probably null
R8074:Sis	UTSW	3	72917198	missense	probably damaging	1.00
R8085:Sis	UTSW	3	72907129	missense	probably damaging	1.00
R8137:Sis	UTSW	3	72889045	missense	probably benign	0.22
R8349:Sis	UTSW	3	72903651	missense	probably damaging	1.00
R8354:Sis	UTSW	3	72947501	missense	possibly damaging	0.84
R8366:Sis	UTSW	3	72958233	missense	probably damaging	1.00
R8449:Sis	UTSW	3	72903651	missense	probably damaging	1.00
R8454:Sis	UTSW	3	72947501	missense	possibly damaging	0.84
R8474:Sis	UTSW	3	72929397	missense	probably damaging	1.00
R8515:Sis	UTSW	3	72929409	missense	probably benign	0.00
R8680:Sis	UTSW	3	72960295	missense	probably damaging	1.00
R8703:Sis	UTSW	3	72960324	missense	probably damaging	1.00
R9098:Sis	UTSW	3	72937245	missense	possibly damaging	0.66
R9466:Sis	UTSW	3	72965577	critical splice donor site	probably null
R9574:Sis	UTSW	3	72921157	missense	probably benign	0.05
R9630:Sis	UTSW	3	72921389	missense	probably benign	0.11
R9680:Sis	UTSW	3	72956288	missense	probably benign	0.12
R9709:Sis	UTSW	3	72891741	missense	possibly damaging	0.47
R9731:Sis	UTSW	3	72928210	missense	probably benign	0.01
X0009:Sis	UTSW	3	72889022	missense	probably damaging	0.99
X0024:Sis	UTSW	3	72928670	missense	probably benign
X0060:Sis	UTSW	3	72920906	intron	probably benign
Z1176:Sis	UTSW	3	72904273	missense	probably benign	0.05
Z1176:Sis	UTSW	3	72943557	missense	probably benign	0.25
Z1177:Sis	UTSW	3	72909172	missense	possibly damaging	0.88
Z1177:Sis	UTSW	3	72910474	missense	probably damaging	1.00
Z1177:Sis	UTSW	3	72943569	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGTAGTCCTGGCAATGACCAC -3'
(R):5'- ACTCCCGATTCAGTATATAAAGCAC -3'

Sequencing Primer
(F):5'- CTGGCAATGACCACGAGGAATC -3'
(R):5'- TCATGTTAGATCACAGCTATG -3'

Posted On

2018-09-12