Incidental Mutation 'R6853:Fga'
ID 535078
Institutional Source Beutler Lab
Gene Symbol Fga
Ensembl Gene ENSMUSG00000028001
Gene Name fibrinogen alpha chain
Synonyms Fib, ENSMUSG00000059807
MMRRC Submission 044956-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.333) question?
Stock # R6853 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 82933460-82940934 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 82938219 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 198 (Y198C)
Ref Sequence ENSEMBL: ENSMUSP00000133117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029630] [ENSMUST00000166581]
AlphaFold E9PV24
Predicted Effect probably damaging
Transcript: ENSMUST00000029630
AA Change: Y198C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029630
Gene: ENSMUSG00000028001
AA Change: Y198C

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 31 43 N/A INTRINSIC
Fib_alpha 49 193 1.29e-69 SMART
low complexity region 264 286 N/A INTRINSIC
low complexity region 311 340 N/A INTRINSIC
Pfam:Fibrinogen_aC 392 458 1.6e-33 PFAM
low complexity region 500 522 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166581
AA Change: Y198C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133117
Gene: ENSMUSG00000028001
AA Change: Y198C

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 31 43 N/A INTRINSIC
Fib_alpha 49 193 1.29e-69 SMART
low complexity region 264 286 N/A INTRINSIC
low complexity region 311 340 N/A INTRINSIC
Pfam:Fibrinogen_aC 392 457 9.3e-34 PFAM
low complexity region 500 522 N/A INTRINSIC
FBG 550 786 1.43e-128 SMART
Meta Mutation Damage Score 0.8566 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: This gene encodes a subunit of the coagulation factor fibrinogen, which is a component of the blood clot. The encoded protein is proteolytically processed by thrombin during the conversion of fibrinogen to fibrin. Mice lacking the encoded protein display bleeding in the peritoneal cavity, skin and soft tissues around joints immediately after birth, and are predisposed to spontaneous fatal abdominal hemorrhage as they grow. Pregnant mice lacking the encoded protein succumb to uterine bleeding during gestation. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for disruptions of this gene have blood that is unable to clot. On some genetic backgrounds this can lead to fatal hemorrhaging. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030458C11Rik G T 15: 12,818,031 (GRCm39) D138E probably benign Het
Atp13a5 A G 16: 29,140,480 (GRCm39) S359P possibly damaging Het
Bcam T C 7: 19,494,331 (GRCm39) D355G probably damaging Het
Bmp8a C A 4: 123,236,476 (GRCm39) W9L unknown Het
Cacul1 A T 19: 60,517,904 (GRCm39) Y334* probably null Het
Ccdc178 A T 18: 22,242,933 (GRCm39) N227K probably benign Het
Ceacam2 T C 7: 25,217,561 (GRCm39) N318S possibly damaging Het
Cntrl T A 2: 35,019,833 (GRCm39) S553R possibly damaging Het
Ctsa T A 2: 164,679,284 (GRCm39) M331K probably benign Het
Cyp2c38 T A 19: 39,426,748 (GRCm39) Q184H probably benign Het
Cyp2c70 C T 19: 40,172,364 (GRCm39) E93K possibly damaging Het
D430041D05Rik C T 2: 104,071,500 (GRCm39) V1267M probably damaging Het
Ddias C T 7: 92,508,773 (GRCm39) A381T possibly damaging Het
Dnhd1 G A 7: 105,352,935 (GRCm39) C2696Y probably benign Het
Efr3a G A 15: 65,701,679 (GRCm39) V198I probably benign Het
Farp2 T C 1: 93,497,738 (GRCm39) F256S probably damaging Het
Gabpa T A 16: 84,657,387 (GRCm39) C421S probably damaging Het
Gm21798 A T 15: 64,689,714 (GRCm39) probably benign Het
Gm21798 A T 15: 64,689,716 (GRCm39) probably benign Het
Gm7145 A C 1: 117,913,874 (GRCm39) N252T possibly damaging Het
H2-Q6 T C 17: 35,647,335 (GRCm39) *327R probably null Het
H6pd T C 4: 150,066,919 (GRCm39) D489G probably benign Het
Htra2 A G 6: 83,030,812 (GRCm39) probably benign Het
Ice1 T G 13: 70,751,421 (GRCm39) E1555A possibly damaging Het
Inpp5d T A 1: 87,609,402 (GRCm39) probably null Het
Itih2 T C 2: 10,120,077 (GRCm39) D320G probably damaging Het
Kif1a T G 1: 92,967,524 (GRCm39) H1129P possibly damaging Het
Kmt2a G A 9: 44,729,704 (GRCm39) probably benign Het
L3mbtl4 G A 17: 69,084,915 (GRCm39) D609N probably damaging Het
Lgals9 A T 11: 78,856,832 (GRCm39) D248E probably benign Het
Lhx9 ACC ACCC 1: 138,769,544 (GRCm39) probably null Het
Msh3 A G 13: 92,449,080 (GRCm39) probably null Het
Mtus2 A G 5: 148,043,821 (GRCm39) K803R probably damaging Het
Oas1a T A 5: 121,045,491 (GRCm39) I17L possibly damaging Het
Or2h2c G A 17: 37,422,400 (GRCm39) T158I probably benign Het
Or5b121 T A 19: 13,507,295 (GRCm39) I130K possibly damaging Het
Or5k15 C T 16: 58,710,121 (GRCm39) S154N possibly damaging Het
Or5k15 T A 16: 58,710,122 (GRCm39) S154C probably damaging Het
Or7g32 T G 9: 19,408,102 (GRCm39) Y19* probably null Het
Otof T C 5: 30,545,583 (GRCm39) D539G probably damaging Het
Pabpc4 T C 4: 123,188,536 (GRCm39) Y382H possibly damaging Het
Rag1 T C 2: 101,472,566 (GRCm39) T859A probably damaging Het
Ralbp1 C T 17: 66,159,751 (GRCm39) R504H possibly damaging Het
Sdk2 A G 11: 113,671,755 (GRCm39) F2131S probably damaging Het
Sik1 A T 17: 32,073,180 (GRCm39) probably null Het
Sis A G 3: 72,798,759 (GRCm39) I1763T possibly damaging Het
Slc39a6 A G 18: 24,732,376 (GRCm39) I304T possibly damaging Het
Slc5a12 A G 2: 110,454,539 (GRCm39) S367G probably benign Het
Smchd1 A T 17: 71,743,738 (GRCm39) W476R probably damaging Het
Spag17 T C 3: 99,920,551 (GRCm39) Y429H possibly damaging Het
Stt3a G A 9: 36,653,023 (GRCm39) S553F possibly damaging Het
Sult2a1 C T 7: 13,535,412 (GRCm39) V214I possibly damaging Het
Supt6 T C 11: 78,123,656 (GRCm39) E38G possibly damaging Het
Tenm4 G A 7: 96,486,502 (GRCm39) G990R possibly damaging Het
Thop1 T C 10: 80,911,495 (GRCm39) probably null Het
Thumpd2 C A 17: 81,372,459 (GRCm39) D11Y possibly damaging Het
Tmf1 T G 6: 97,145,810 (GRCm39) I574L probably damaging Het
Tnfaip3 A G 10: 18,879,499 (GRCm39) V623A probably benign Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,376,118 (GRCm39) probably null Het
Ush2a T G 1: 188,643,434 (GRCm39) Y4265* probably null Het
Vamp5 G A 6: 72,357,424 (GRCm39) probably benign Het
Vmn2r12 A T 5: 109,240,771 (GRCm39) L114Q probably damaging Het
Vmn2r98 A T 17: 19,286,063 (GRCm39) Y187F probably benign Het
Other mutations in Fga
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Fga APN 3 82,938,981 (GRCm39) missense probably damaging 1.00
IGL00478:Fga APN 3 82,935,951 (GRCm39) missense probably benign 0.00
IGL00587:Fga APN 3 82,937,596 (GRCm39) missense possibly damaging 0.62
IGL01289:Fga APN 3 82,938,552 (GRCm39) missense possibly damaging 0.85
IGL01323:Fga APN 3 82,937,518 (GRCm39) missense probably damaging 0.99
IGL01369:Fga APN 3 82,937,507 (GRCm39) missense probably benign 0.00
IGL01409:Fga APN 3 82,940,059 (GRCm39) missense probably damaging 1.00
IGL01541:Fga APN 3 82,940,014 (GRCm39) missense probably damaging 1.00
IGL01633:Fga APN 3 82,937,606 (GRCm39) missense possibly damaging 0.89
IGL01966:Fga APN 3 82,936,461 (GRCm39) missense probably damaging 0.97
IGL02651:Fga APN 3 82,935,841 (GRCm39) missense probably benign 0.00
IGL02822:Fga APN 3 82,938,789 (GRCm39) missense probably damaging 1.00
IGL03003:Fga APN 3 82,940,037 (GRCm39) missense probably damaging 1.00
R0336:Fga UTSW 3 82,938,164 (GRCm39) missense probably damaging 1.00
R0540:Fga UTSW 3 82,935,869 (GRCm39) missense probably damaging 1.00
R0607:Fga UTSW 3 82,935,869 (GRCm39) missense probably damaging 1.00
R1471:Fga UTSW 3 82,935,925 (GRCm39) missense probably benign 0.16
R1517:Fga UTSW 3 82,939,145 (GRCm39) missense probably benign 0.00
R1817:Fga UTSW 3 82,939,082 (GRCm39) missense probably benign 0.00
R1874:Fga UTSW 3 82,940,028 (GRCm39) missense probably damaging 1.00
R2014:Fga UTSW 3 82,940,064 (GRCm39) missense probably damaging 0.99
R2267:Fga UTSW 3 82,940,257 (GRCm39) missense probably damaging 1.00
R2332:Fga UTSW 3 82,938,704 (GRCm39) missense probably damaging 1.00
R2420:Fga UTSW 3 82,940,461 (GRCm39) missense possibly damaging 0.53
R2443:Fga UTSW 3 82,935,848 (GRCm39) missense probably benign 0.03
R3978:Fga UTSW 3 82,937,490 (GRCm39) critical splice acceptor site probably null
R4597:Fga UTSW 3 82,938,542 (GRCm39) nonsense probably null
R4644:Fga UTSW 3 82,937,573 (GRCm39) missense possibly damaging 0.81
R4760:Fga UTSW 3 82,938,821 (GRCm39) missense probably benign
R4867:Fga UTSW 3 82,935,951 (GRCm39) missense probably benign 0.00
R5449:Fga UTSW 3 82,938,169 (GRCm39) frame shift probably null
R5507:Fga UTSW 3 82,940,643 (GRCm39) missense probably damaging 1.00
R5712:Fga UTSW 3 82,940,440 (GRCm39) missense possibly damaging 0.70
R6865:Fga UTSW 3 82,938,848 (GRCm39) missense probably damaging 1.00
R7163:Fga UTSW 3 82,933,571 (GRCm39) missense probably benign 0.04
R7724:Fga UTSW 3 82,936,432 (GRCm39) missense probably damaging 0.99
R8153:Fga UTSW 3 82,938,164 (GRCm39) missense probably damaging 1.00
R8506:Fga UTSW 3 82,940,623 (GRCm39) missense probably damaging 1.00
R8511:Fga UTSW 3 82,939,064 (GRCm39) nonsense probably null
R8523:Fga UTSW 3 82,938,158 (GRCm39) missense probably damaging 1.00
R8801:Fga UTSW 3 82,938,188 (GRCm39) missense possibly damaging 0.89
R8906:Fga UTSW 3 82,939,111 (GRCm39) missense probably benign 0.12
R9390:Fga UTSW 3 82,940,610 (GRCm39) missense probably damaging 1.00
R9609:Fga UTSW 3 82,940,064 (GRCm39) missense probably damaging 1.00
X0062:Fga UTSW 3 82,937,578 (GRCm39) missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- CTCCACAGCTTCCTTTGAGG -3'
(R):5'- ATCTGCCGCATTTCTGTTAATG -3'

Sequencing Primer
(F):5'- GACCAGCCTGAGTAGCTAAAGAC -3'
(R):5'- TGTTAATGCCTTCCACTCTGG -3'
Posted On 2018-09-12