Incidental Mutation 'R6853:H6pd'
ID535082
Institutional Source Beutler Lab
Gene Symbol H6pd
Ensembl Gene ENSMUSG00000028980
Gene Namehexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase)
SynonymsGpd-1, Gpd1, G6pd1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R6853 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location149979475-150009023 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 149982462 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 489 (D489G)
Ref Sequence ENSEMBL: ENSMUSP00000081134 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030830] [ENSMUST00000084117]
Predicted Effect probably benign
Transcript: ENSMUST00000030830
AA Change: D497G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000030830
Gene: ENSMUSG00000028980
AA Change: D497G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:G6PD_N 34 218 1.6e-41 PFAM
Pfam:G6PD_C 220 523 3.2e-58 PFAM
Pfam:Glucosamine_iso 564 788 8.2e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000084117
AA Change: D489G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000081134
Gene: ENSMUSG00000028980
AA Change: D489G

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:G6PD_N 26 210 8.6e-39 PFAM
Pfam:G6PD_C 212 387 3.6e-42 PFAM
Pfam:Glucosamine_iso 561 758 9.9e-62 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] There are 2 forms of glucose-6-phosphate dehydrogenase. G form is X-linked and H form, encoded by this gene, is autosomally linked. This H form shows activity with other hexose-6-phosphates, especially galactose-6-phosphate, whereas the G form is specific for glucose-6-phosphate. Both forms are present in most tissues, but H form is not found in red cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show enlarged adrenal glands, reduced plasma corticosterone levels and altered 11 beta-hydroxysteroid dehydrogenase type 1 enzyme activity. Treatment with 11-dehydrocorticosterone fails to inhibit glucose-stimulatedinsulin secretion in pancreatic islets. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030458C11Rik G T 15: 12,817,945 D138E probably benign Het
Atp13a5 A G 16: 29,321,662 S359P possibly damaging Het
Bcam T C 7: 19,760,406 D355G probably damaging Het
Bmp8a C A 4: 123,342,683 W9L unknown Het
Cacul1 A T 19: 60,529,466 Y334* probably null Het
Ccdc178 A T 18: 22,109,876 N227K probably benign Het
Ceacam2 T C 7: 25,518,136 N318S possibly damaging Het
Cntrl T A 2: 35,129,821 S553R possibly damaging Het
Ctsa T A 2: 164,837,364 M331K probably benign Het
Cyp2c38 T A 19: 39,438,304 Q184H probably benign Het
Cyp2c70 C T 19: 40,183,920 E93K possibly damaging Het
D430041D05Rik C T 2: 104,241,155 V1267M probably damaging Het
Ddias C T 7: 92,859,565 A381T possibly damaging Het
Dnhd1 G A 7: 105,703,728 C2696Y probably benign Het
Efr3a G A 15: 65,829,830 V198I probably benign Het
Farp2 T C 1: 93,570,016 F256S probably damaging Het
Fga A G 3: 83,030,912 Y198C probably damaging Het
Gabpa T A 16: 84,860,499 C421S probably damaging Het
Gm21798 A T 15: 64,817,865 probably benign Het
Gm21798 A T 15: 64,817,867 probably benign Het
Gm7145 A C 1: 117,986,144 N252T possibly damaging Het
H2-Q6 T C 17: 35,428,359 *327R probably null Het
Htra2 A G 6: 83,053,831 probably benign Het
Ice1 T G 13: 70,603,302 E1555A possibly damaging Het
Inpp5d T A 1: 87,681,680 probably null Het
Itih2 T C 2: 10,115,266 D320G probably damaging Het
Kif1a T G 1: 93,039,802 H1129P possibly damaging Het
Kmt2a G A 9: 44,818,407 probably benign Het
L3mbtl4 G A 17: 68,777,920 D609N probably damaging Het
Lgals9 A T 11: 78,966,006 D248E probably benign Het
Lhx9 ACC ACCC 1: 138,841,806 probably null Het
Msh3 A G 13: 92,312,572 probably null Het
Mtus2 A G 5: 148,107,011 K803R probably damaging Het
Oas1a T A 5: 120,907,428 I17L possibly damaging Het
Olfr1480 T A 19: 13,529,931 I130K possibly damaging Het
Olfr178 C T 16: 58,889,758 S154N possibly damaging Het
Olfr178 T A 16: 58,889,759 S154C probably damaging Het
Olfr851 T G 9: 19,496,806 Y19* probably null Het
Olfr92 G A 17: 37,111,508 T158I probably benign Het
Otof T C 5: 30,388,239 D539G probably damaging Het
Pabpc4 T C 4: 123,294,743 Y382H possibly damaging Het
Rag1 T C 2: 101,642,221 T859A probably damaging Het
Ralbp1 C T 17: 65,852,756 R504H possibly damaging Het
Sdk2 A G 11: 113,780,929 F2131S probably damaging Het
Sik1 A T 17: 31,854,206 probably null Het
Sis A G 3: 72,891,426 I1763T possibly damaging Het
Slc39a6 A G 18: 24,599,319 I304T possibly damaging Het
Slc5a12 A G 2: 110,624,194 S367G probably benign Het
Smchd1 A T 17: 71,436,743 W476R probably damaging Het
Spag17 T C 3: 100,013,235 Y429H possibly damaging Het
Stt3a G A 9: 36,741,727 S553F possibly damaging Het
Sult2a1 C T 7: 13,801,487 V214I possibly damaging Het
Supt6 T C 11: 78,232,830 E38G possibly damaging Het
Tenm4 G A 7: 96,837,295 G990R possibly damaging Het
Thop1 T C 10: 81,075,661 probably null Het
Thumpd2 C A 17: 81,065,030 D11Y possibly damaging Het
Tmf1 T G 6: 97,168,849 I574L probably damaging Het
Tnfaip3 A G 10: 19,003,751 V623A probably benign Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Ush2a T G 1: 188,911,237 Y4265* probably null Het
Vamp5 G A 6: 72,380,441 probably benign Het
Vmn2r12 A T 5: 109,092,905 L114Q probably damaging Het
Vmn2r98 A T 17: 19,065,801 Y187F probably benign Het
Other mutations in H6pd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:H6pd APN 4 149994468 critical splice donor site probably null
IGL01450:H6pd APN 4 149984118 missense probably damaging 1.00
IGL01913:H6pd APN 4 149994463 unclassified probably benign
IGL01914:H6pd APN 4 149994463 unclassified probably benign
dryer UTSW 4 149982865 missense probably damaging 1.00
herr UTSW 4 149983902 critical splice donor site probably null
R0402:H6pd UTSW 4 149996316 missense probably damaging 1.00
R0486:H6pd UTSW 4 149982936 splice site probably benign
R0548:H6pd UTSW 4 149981616 missense probably damaging 1.00
R0690:H6pd UTSW 4 149982573 missense possibly damaging 0.93
R1165:H6pd UTSW 4 149995956 missense possibly damaging 0.95
R1298:H6pd UTSW 4 149982514 missense probably benign 0.01
R1331:H6pd UTSW 4 149982415 missense probably benign 0.28
R1581:H6pd UTSW 4 149982514 missense possibly damaging 0.94
R1781:H6pd UTSW 4 149995931 missense probably damaging 1.00
R1791:H6pd UTSW 4 149981673 missense probably damaging 0.97
R1840:H6pd UTSW 4 149982050 missense possibly damaging 0.55
R2290:H6pd UTSW 4 149981881 missense probably damaging 1.00
R3889:H6pd UTSW 4 149995773 missense possibly damaging 0.67
R4432:H6pd UTSW 4 149995758 missense probably damaging 1.00
R4576:H6pd UTSW 4 149994476 missense probably damaging 0.99
R4629:H6pd UTSW 4 149996346 missense probably benign 0.10
R4856:H6pd UTSW 4 149982778 missense possibly damaging 0.47
R4886:H6pd UTSW 4 149982778 missense possibly damaging 0.47
R4951:H6pd UTSW 4 149981587 missense probably damaging 1.00
R5124:H6pd UTSW 4 149982055 missense possibly damaging 0.57
R5337:H6pd UTSW 4 149981784 missense probably benign 0.02
R5408:H6pd UTSW 4 149982865 missense probably damaging 1.00
R5474:H6pd UTSW 4 149996089 missense probably damaging 1.00
R6266:H6pd UTSW 4 149995957 missense probably benign 0.32
R6476:H6pd UTSW 4 149982727 missense probably damaging 0.99
R6725:H6pd UTSW 4 149996358 missense probably damaging 1.00
R6733:H6pd UTSW 4 149985121 intron probably null
R6785:H6pd UTSW 4 149982790 missense possibly damaging 0.50
R6921:H6pd UTSW 4 149982051 missense probably damaging 0.99
R7258:H6pd UTSW 4 149996362 missense probably benign 0.09
R7269:H6pd UTSW 4 149982912 missense probably benign 0.00
R7326:H6pd UTSW 4 149996350 missense probably benign 0.00
R7348:H6pd UTSW 4 149983902 critical splice donor site probably null
R7488:H6pd UTSW 4 149982636 missense probably benign
R7512:H6pd UTSW 4 149995948 missense probably benign 0.00
R7684:H6pd UTSW 4 149996062 missense probably benign
R7704:H6pd UTSW 4 149982903 missense probably benign 0.45
X0020:H6pd UTSW 4 149982798 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTGGGCTCTGTCTATACCG -3'
(R):5'- AGCCGGAACCTGTTCAAACC -3'

Sequencing Primer
(F):5'- TGTCTATACCGGGCCCC -3'
(R):5'- GGAACCTGTTCAAACCCTCAC -3'
Posted On2018-09-12