Incidental Mutation 'R6853:Ttll3'
ID535090
Institutional Source Beutler Lab
Gene Symbol Ttll3
Ensembl Gene ENSMUSG00000030276
Gene Nametubulin tyrosine ligase-like family, member 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6853 (G1)
Quality Score217.468
Status Validated
Chromosome6
Chromosomal Location113389260-113414587 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CAAAGTAA to CAAAGTAAAGTAA at 113399157 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032414] [ENSMUST00000038889] [ENSMUST00000204026] [ENSMUST00000205017]
Predicted Effect probably benign
Transcript: ENSMUST00000032414
SMART Domains Protein: ENSMUSP00000032414
Gene: ENSMUSG00000030276

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
low complexity region 214 231 N/A INTRINSIC
low complexity region 234 248 N/A INTRINSIC
Pfam:TTL 404 698 7.7e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000038889
SMART Domains Protein: ENSMUSP00000037870
Gene: ENSMUSG00000030276

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
low complexity region 214 231 N/A INTRINSIC
low complexity region 234 248 N/A INTRINSIC
Pfam:TTL 404 699 9e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203524
Predicted Effect probably null
Transcript: ENSMUST00000204026
SMART Domains Protein: ENSMUSP00000145049
Gene: ENSMUSG00000030276

DomainStartEndE-ValueType
low complexity region 66 83 N/A INTRINSIC
low complexity region 86 100 N/A INTRINSIC
low complexity region 248 259 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205017
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 98% (63/64)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit a reduced number of primary cilia in colon epithelia accompanied by an increased rate of cell division which is compensated by faster tissue turnover in the colon. Mice exhibit increased incidence of colon tumors by chemical induction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030458C11Rik G T 15: 12,817,945 D138E probably benign Het
Atp13a5 A G 16: 29,321,662 S359P possibly damaging Het
Bcam T C 7: 19,760,406 D355G probably damaging Het
Bmp8a C A 4: 123,342,683 W9L unknown Het
Cacul1 A T 19: 60,529,466 Y334* probably null Het
Ccdc178 A T 18: 22,109,876 N227K probably benign Het
Ceacam2 T C 7: 25,518,136 N318S possibly damaging Het
Cntrl T A 2: 35,129,821 S553R possibly damaging Het
Ctsa T A 2: 164,837,364 M331K probably benign Het
Cyp2c38 T A 19: 39,438,304 Q184H probably benign Het
Cyp2c70 C T 19: 40,183,920 E93K possibly damaging Het
D430041D05Rik C T 2: 104,241,155 V1267M probably damaging Het
Ddias C T 7: 92,859,565 A381T possibly damaging Het
Dnhd1 G A 7: 105,703,728 C2696Y probably benign Het
Efr3a G A 15: 65,829,830 V198I probably benign Het
Farp2 T C 1: 93,570,016 F256S probably damaging Het
Fga A G 3: 83,030,912 Y198C probably damaging Het
Gabpa T A 16: 84,860,499 C421S probably damaging Het
Gm21798 A T 15: 64,817,865 probably benign Het
Gm21798 A T 15: 64,817,867 probably benign Het
Gm7145 A C 1: 117,986,144 N252T possibly damaging Het
H2-Q6 T C 17: 35,428,359 *327R probably null Het
H6pd T C 4: 149,982,462 D489G probably benign Het
Htra2 A G 6: 83,053,831 probably benign Het
Ice1 T G 13: 70,603,302 E1555A possibly damaging Het
Inpp5d T A 1: 87,681,680 probably null Het
Itih2 T C 2: 10,115,266 D320G probably damaging Het
Kif1a T G 1: 93,039,802 H1129P possibly damaging Het
Kmt2a G A 9: 44,818,407 probably benign Het
L3mbtl4 G A 17: 68,777,920 D609N probably damaging Het
Lgals9 A T 11: 78,966,006 D248E probably benign Het
Lhx9 ACC ACCC 1: 138,841,806 probably null Het
Msh3 A G 13: 92,312,572 probably null Het
Mtus2 A G 5: 148,107,011 K803R probably damaging Het
Oas1a T A 5: 120,907,428 I17L possibly damaging Het
Olfr1480 T A 19: 13,529,931 I130K possibly damaging Het
Olfr178 C T 16: 58,889,758 S154N possibly damaging Het
Olfr178 T A 16: 58,889,759 S154C probably damaging Het
Olfr851 T G 9: 19,496,806 Y19* probably null Het
Olfr92 G A 17: 37,111,508 T158I probably benign Het
Otof T C 5: 30,388,239 D539G probably damaging Het
Pabpc4 T C 4: 123,294,743 Y382H possibly damaging Het
Rag1 T C 2: 101,642,221 T859A probably damaging Het
Ralbp1 C T 17: 65,852,756 R504H possibly damaging Het
Sdk2 A G 11: 113,780,929 F2131S probably damaging Het
Sik1 A T 17: 31,854,206 probably null Het
Sis A G 3: 72,891,426 I1763T possibly damaging Het
Slc39a6 A G 18: 24,599,319 I304T possibly damaging Het
Slc5a12 A G 2: 110,624,194 S367G probably benign Het
Smchd1 A T 17: 71,436,743 W476R probably damaging Het
Spag17 T C 3: 100,013,235 Y429H possibly damaging Het
Stt3a G A 9: 36,741,727 S553F possibly damaging Het
Sult2a1 C T 7: 13,801,487 V214I possibly damaging Het
Supt6 T C 11: 78,232,830 E38G possibly damaging Het
Tenm4 G A 7: 96,837,295 G990R possibly damaging Het
Thop1 T C 10: 81,075,661 probably null Het
Thumpd2 C A 17: 81,065,030 D11Y possibly damaging Het
Tmf1 T G 6: 97,168,849 I574L probably damaging Het
Tnfaip3 A G 10: 19,003,751 V623A probably benign Het
Ush2a T G 1: 188,911,237 Y4265* probably null Het
Vamp5 G A 6: 72,380,441 probably benign Het
Vmn2r12 A T 5: 109,092,905 L114Q probably damaging Het
Vmn2r98 A T 17: 19,065,801 Y187F probably benign Het
Other mutations in Ttll3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01338:Ttll3 APN 6 113394729 missense probably damaging 1.00
IGL01677:Ttll3 APN 6 113412984 missense probably benign
IGL01697:Ttll3 APN 6 113399729 missense probably benign 0.00
IGL01944:Ttll3 APN 6 113414115 missense probably benign
IGL02688:Ttll3 APN 6 113399739 missense probably benign 0.00
IGL03068:Ttll3 APN 6 113409197 missense probably damaging 1.00
R0373:Ttll3 UTSW 6 113398777 missense probably damaging 1.00
R0472:Ttll3 UTSW 6 113409339 missense probably damaging 1.00
R0625:Ttll3 UTSW 6 113408903 critical splice acceptor site probably null
R1868:Ttll3 UTSW 6 113392764 missense possibly damaging 0.95
R2026:Ttll3 UTSW 6 113398770 missense probably damaging 1.00
R2061:Ttll3 UTSW 6 113409042 missense possibly damaging 0.76
R2128:Ttll3 UTSW 6 113412934 missense probably benign 0.31
R2896:Ttll3 UTSW 6 113392722 missense probably benign 0.15
R2903:Ttll3 UTSW 6 113407323 missense probably damaging 0.99
R2906:Ttll3 UTSW 6 113392510 unclassified probably benign
R4659:Ttll3 UTSW 6 113414141 missense probably benign
R4746:Ttll3 UTSW 6 113407392 missense probably damaging 1.00
R4984:Ttll3 UTSW 6 113412940 missense probably benign 0.00
R5358:Ttll3 UTSW 6 113401331 missense probably benign 0.26
R5372:Ttll3 UTSW 6 113401421 nonsense probably null
R5525:Ttll3 UTSW 6 113412978 missense probably benign
R5548:Ttll3 UTSW 6 113393117 missense probably damaging 1.00
R5694:Ttll3 UTSW 6 113399708 missense probably damaging 1.00
R5993:Ttll3 UTSW 6 113398031 nonsense probably null
R6119:Ttll3 UTSW 6 113394741 missense probably damaging 1.00
R6268:Ttll3 UTSW 6 113392563 missense probably benign 0.00
R6719:Ttll3 UTSW 6 113399032 intron probably benign
R6852:Ttll3 UTSW 6 113399155 frame shift probably null
R6852:Ttll3 UTSW 6 113399157 frame shift probably null
R6852:Ttll3 UTSW 6 113399159 frame shift probably null
R6854:Ttll3 UTSW 6 113399157 frame shift probably null
R7170:Ttll3 UTSW 6 113413878 missense probably benign 0.41
R7239:Ttll3 UTSW 6 113399157 frame shift probably null
R7302:Ttll3 UTSW 6 113409285 missense probably damaging 1.00
R7330:Ttll3 UTSW 6 113399157 frame shift probably null
R7330:Ttll3 UTSW 6 113399164 frame shift probably null
R7586:Ttll3 UTSW 6 113399157 frame shift probably null
R7586:Ttll3 UTSW 6 113399160 frame shift probably null
R7586:Ttll3 UTSW 6 113399163 frame shift probably null
R7587:Ttll3 UTSW 6 113399157 frame shift probably null
R7701:Ttll3 UTSW 6 113399157 frame shift probably null
R7702:Ttll3 UTSW 6 113399157 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AAAGAGCAAGCCTCCCCTTG -3'
(R):5'- TGGCCTGGACCAGTTTCATTTC -3'

Sequencing Primer
(F):5'- TGTGGCCTCTGTAACCCCAG -3'
(R):5'- GCTGCCTTGGAACTCACTATGAAG -3'
Posted On2018-09-12