Incidental Mutation 'R6853:Thop1'
ID535101
Institutional Source Beutler Lab
Gene Symbol Thop1
Ensembl Gene ENSMUSG00000004929
Gene Namethimet oligopeptidase 1
SynonymsEP24.15
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.676) question?
Stock #R6853 (G1)
Quality Score124.008
Status Validated
Chromosome10
Chromosomal Location81070035-81082559 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 81075661 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000005057 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005057]
Predicted Effect probably null
Transcript: ENSMUST00000005057
SMART Domains Protein: ENSMUSP00000005057
Gene: ENSMUSG00000004929

DomainStartEndE-ValueType
Pfam:Peptidase_M3 227 677 7e-165 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a kininase that uses zinc as a cofactor. The encoded oligopeptidase cleaves cytosolic peptides, making them unavailable for display on antigen-presenting cells. This protein also cleaves neuropeptides under 20 aa in length and can degrade beta-amyloid precursor protein to amyloidogenic peptides. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030458C11Rik G T 15: 12,817,945 D138E probably benign Het
Atp13a5 A G 16: 29,321,662 S359P possibly damaging Het
Bcam T C 7: 19,760,406 D355G probably damaging Het
Bmp8a C A 4: 123,342,683 W9L unknown Het
Cacul1 A T 19: 60,529,466 Y334* probably null Het
Ccdc178 A T 18: 22,109,876 N227K probably benign Het
Ceacam2 T C 7: 25,518,136 N318S possibly damaging Het
Cntrl T A 2: 35,129,821 S553R possibly damaging Het
Ctsa T A 2: 164,837,364 M331K probably benign Het
Cyp2c38 T A 19: 39,438,304 Q184H probably benign Het
Cyp2c70 C T 19: 40,183,920 E93K possibly damaging Het
D430041D05Rik C T 2: 104,241,155 V1267M probably damaging Het
Ddias C T 7: 92,859,565 A381T possibly damaging Het
Dnhd1 G A 7: 105,703,728 C2696Y probably benign Het
Efr3a G A 15: 65,829,830 V198I probably benign Het
Farp2 T C 1: 93,570,016 F256S probably damaging Het
Fga A G 3: 83,030,912 Y198C probably damaging Het
Gabpa T A 16: 84,860,499 C421S probably damaging Het
Gm21798 A T 15: 64,817,865 probably benign Het
Gm21798 A T 15: 64,817,867 probably benign Het
Gm7145 A C 1: 117,986,144 N252T possibly damaging Het
H2-Q6 T C 17: 35,428,359 *327R probably null Het
H6pd T C 4: 149,982,462 D489G probably benign Het
Htra2 A G 6: 83,053,831 probably benign Het
Ice1 T G 13: 70,603,302 E1555A possibly damaging Het
Inpp5d T A 1: 87,681,680 probably null Het
Itih2 T C 2: 10,115,266 D320G probably damaging Het
Kif1a T G 1: 93,039,802 H1129P possibly damaging Het
Kmt2a G A 9: 44,818,407 probably benign Het
L3mbtl4 G A 17: 68,777,920 D609N probably damaging Het
Lgals9 A T 11: 78,966,006 D248E probably benign Het
Lhx9 ACC ACCC 1: 138,841,806 probably null Het
Msh3 A G 13: 92,312,572 probably null Het
Mtus2 A G 5: 148,107,011 K803R probably damaging Het
Oas1a T A 5: 120,907,428 I17L possibly damaging Het
Olfr1480 T A 19: 13,529,931 I130K possibly damaging Het
Olfr178 C T 16: 58,889,758 S154N possibly damaging Het
Olfr178 T A 16: 58,889,759 S154C probably damaging Het
Olfr851 T G 9: 19,496,806 Y19* probably null Het
Olfr92 G A 17: 37,111,508 T158I probably benign Het
Otof T C 5: 30,388,239 D539G probably damaging Het
Pabpc4 T C 4: 123,294,743 Y382H possibly damaging Het
Rag1 T C 2: 101,642,221 T859A probably damaging Het
Ralbp1 C T 17: 65,852,756 R504H possibly damaging Het
Sdk2 A G 11: 113,780,929 F2131S probably damaging Het
Sik1 A T 17: 31,854,206 probably null Het
Sis A G 3: 72,891,426 I1763T possibly damaging Het
Slc39a6 A G 18: 24,599,319 I304T possibly damaging Het
Slc5a12 A G 2: 110,624,194 S367G probably benign Het
Smchd1 A T 17: 71,436,743 W476R probably damaging Het
Spag17 T C 3: 100,013,235 Y429H possibly damaging Het
Stt3a G A 9: 36,741,727 S553F possibly damaging Het
Sult2a1 C T 7: 13,801,487 V214I possibly damaging Het
Supt6 T C 11: 78,232,830 E38G possibly damaging Het
Tenm4 G A 7: 96,837,295 G990R possibly damaging Het
Thumpd2 C A 17: 81,065,030 D11Y possibly damaging Het
Tmf1 T G 6: 97,168,849 I574L probably damaging Het
Tnfaip3 A G 10: 19,003,751 V623A probably benign Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Ush2a T G 1: 188,911,237 Y4265* probably null Het
Vamp5 G A 6: 72,380,441 probably benign Het
Vmn2r12 A T 5: 109,092,905 L114Q probably damaging Het
Vmn2r98 A T 17: 19,065,801 Y187F probably benign Het
Other mutations in Thop1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00792:Thop1 APN 10 81078599 nonsense probably null
IGL00987:Thop1 APN 10 81081695 missense probably damaging 0.99
R0241:Thop1 UTSW 10 81080245 unclassified probably benign
R0842:Thop1 UTSW 10 81075577 missense probably damaging 1.00
R1800:Thop1 UTSW 10 81073209 missense probably damaging 1.00
R1863:Thop1 UTSW 10 81073317 missense probably damaging 0.98
R2507:Thop1 UTSW 10 81070264 start codon destroyed probably null 0.47
R2905:Thop1 UTSW 10 81079591 missense probably damaging 1.00
R2930:Thop1 UTSW 10 81073314 missense probably damaging 0.98
R3898:Thop1 UTSW 10 81080444 missense probably damaging 1.00
R3899:Thop1 UTSW 10 81080444 missense probably damaging 1.00
R4911:Thop1 UTSW 10 81073291 missense probably damaging 1.00
R4924:Thop1 UTSW 10 81080194 missense probably benign 0.11
R4926:Thop1 UTSW 10 81073367 critical splice donor site probably null
R5092:Thop1 UTSW 10 81080578 missense probably damaging 1.00
R5968:Thop1 UTSW 10 81075559 missense probably benign 0.07
R6370:Thop1 UTSW 10 81077983 missense probably benign 0.00
R6733:Thop1 UTSW 10 81081412 missense probably damaging 0.98
R7355:Thop1 UTSW 10 81075631 missense probably damaging 1.00
R7750:Thop1 UTSW 10 81080191 missense probably benign
R8030:Thop1 UTSW 10 81075616 missense possibly damaging 0.91
R8070:Thop1 UTSW 10 81079486 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAACGGTGTCTTGGCATCAG -3'
(R):5'- CCGTTACAGCTATTTCCACAAC -3'

Sequencing Primer
(F):5'- GTGTGCGCCTCTCACCTTG -3'
(R):5'- CAAAGACCTTGACCTCCCTGAG -3'
Posted On2018-09-12