Mutagenetix > Incidental Mutations

Incidental Mutation 'R6853:Sdk2'

535104

Institutional Source

Beutler Lab

Gene Symbol

Sdk2

Ensembl Gene

ENSMUSG00000041592

Gene Name

sidekick cell adhesion molecule 2

Synonyms

5330435L01Rik, 4632412F08Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.092) question?

Stock #

R6853 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

113776374-114067046 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 113780929 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 2131 (F2131S)

Ref Sequence

ENSEMBL: ENSMUSP00000038972 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041627]

Predicted Effect

probably damaging
Transcript: ENSMUST00000041627
AA Change: F2131S

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000038972
Gene: ENSMUSG00000041592
AA Change: F2131S

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IGc2	43	102	4.67e-4	SMART
IG	123	208	6.07e-3	SMART
IG	225	309	1.4e-7	SMART
IGc2	325	391	6.21e-9	SMART
IGc2	418	486	8.57e-12	SMART
IG	506	591	2.37e-5	SMART
FN3	594	678	1.91e-7	SMART
FN3	694	780	2.42e-9	SMART
FN3	796	884	3.45e-5	SMART
FN3	899	981	2.36e-12	SMART
FN3	997	1084	1.64e-6	SMART
FN3	1101	1188	8.83e-12	SMART
FN3	1204	1289	3.62e-8	SMART
FN3	1305	1388	1.74e-10	SMART
FN3	1404	1489	8.23e-12	SMART
FN3	1506	1612	3.62e-8	SMART
FN3	1628	1713	1.15e-10	SMART
FN3	1728	1815	2.17e-11	SMART
FN3	1829	1913	5.04e-7	SMART
transmembrane domain	1935	1957	N/A	INTRINSIC
low complexity region	2138	2153	N/A	INTRINSIC

Meta Mutation Damage Score

0.1145

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.0%

Validation Efficiency

98% (63/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. The protein contains two immunoglobulin domains and thirteen fibronectin type III domains. Fibronectin type III domains are present in both extracellular and intracellular proteins and tandem repeats are known to contain binding sites for DNA, heparin and the cell surface. This protein, and a homologous mouse sequence, are very similar to the Drosophila sidekick gene product but the specific function of this superfamily member is not yet known. Evidence for alternative splicing at this gene locus has been observed but the full-length nature of additional variants has not yet been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired interconnectvity between VG3 amacrine cells and W3B retinal ganglion cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6030458C11Rik	G	T	15: 12,817,945	D138E	probably benign	Het
Atp13a5	A	G	16: 29,321,662	S359P	possibly damaging	Het
Bcam	T	C	7: 19,760,406	D355G	probably damaging	Het
Bmp8a	C	A	4: 123,342,683	W9L	unknown	Het
Cacul1	A	T	19: 60,529,466	Y334*	probably null	Het
Ccdc178	A	T	18: 22,109,876	N227K	probably benign	Het
Ceacam2	T	C	7: 25,518,136	N318S	possibly damaging	Het
Cntrl	T	A	2: 35,129,821	S553R	possibly damaging	Het
Ctsa	T	A	2: 164,837,364	M331K	probably benign	Het
Cyp2c38	T	A	19: 39,438,304	Q184H	probably benign	Het
Cyp2c70	C	T	19: 40,183,920	E93K	possibly damaging	Het
D430041D05Rik	C	T	2: 104,241,155	V1267M	probably damaging	Het
Ddias	C	T	7: 92,859,565	A381T	possibly damaging	Het
Dnhd1	G	A	7: 105,703,728	C2696Y	probably benign	Het
Efr3a	G	A	15: 65,829,830	V198I	probably benign	Het
Farp2	T	C	1: 93,570,016	F256S	probably damaging	Het
Fga	A	G	3: 83,030,912	Y198C	probably damaging	Het
Gabpa	T	A	16: 84,860,499	C421S	probably damaging	Het
Gm21798	A	T	15: 64,817,865		probably benign	Het
Gm21798	A	T	15: 64,817,867		probably benign	Het
Gm7145	A	C	1: 117,986,144	N252T	possibly damaging	Het
H2-Q6	T	C	17: 35,428,359	*327R	probably null	Het
H6pd	T	C	4: 149,982,462	D489G	probably benign	Het
Htra2	A	G	6: 83,053,831		probably benign	Het
Ice1	T	G	13: 70,603,302	E1555A	possibly damaging	Het
Inpp5d	T	A	1: 87,681,680		probably null	Het
Itih2	T	C	2: 10,115,266	D320G	probably damaging	Het
Kif1a	T	G	1: 93,039,802	H1129P	possibly damaging	Het
Kmt2a	G	A	9: 44,818,407		probably benign	Het
L3mbtl4	G	A	17: 68,777,920	D609N	probably damaging	Het
Lgals9	A	T	11: 78,966,006	D248E	probably benign	Het
Lhx9	ACC	ACCC	1: 138,841,806		probably null	Het
Msh3	A	G	13: 92,312,572		probably null	Het
Mtus2	A	G	5: 148,107,011	K803R	probably damaging	Het
Oas1a	T	A	5: 120,907,428	I17L	possibly damaging	Het
Olfr1480	T	A	19: 13,529,931	I130K	possibly damaging	Het
Olfr178	C	T	16: 58,889,758	S154N	possibly damaging	Het
Olfr178	T	A	16: 58,889,759	S154C	probably damaging	Het
Olfr851	T	G	9: 19,496,806	Y19*	probably null	Het
Olfr92	G	A	17: 37,111,508	T158I	probably benign	Het
Otof	T	C	5: 30,388,239	D539G	probably damaging	Het
Pabpc4	T	C	4: 123,294,743	Y382H	possibly damaging	Het
Rag1	T	C	2: 101,642,221	T859A	probably damaging	Het
Ralbp1	C	T	17: 65,852,756	R504H	possibly damaging	Het
Sik1	A	T	17: 31,854,206		probably null	Het
Sis	A	G	3: 72,891,426	I1763T	possibly damaging	Het
Slc39a6	A	G	18: 24,599,319	I304T	possibly damaging	Het
Slc5a12	A	G	2: 110,624,194	S367G	probably benign	Het
Smchd1	A	T	17: 71,436,743	W476R	probably damaging	Het
Spag17	T	C	3: 100,013,235	Y429H	possibly damaging	Het
Stt3a	G	A	9: 36,741,727	S553F	possibly damaging	Het
Sult2a1	C	T	7: 13,801,487	V214I	possibly damaging	Het
Supt6	T	C	11: 78,232,830	E38G	possibly damaging	Het
Tenm4	G	A	7: 96,837,295	G990R	possibly damaging	Het
Thop1	T	C	10: 81,075,661		probably null	Het
Thumpd2	C	A	17: 81,065,030	D11Y	possibly damaging	Het
Tmf1	T	G	6: 97,168,849	I574L	probably damaging	Het
Tnfaip3	A	G	10: 19,003,751	V623A	probably benign	Het
Ttll3	CAAAGTAA	CAAAGTAAAGTAA	6: 113,399,157		probably null	Het
Ush2a	T	G	1: 188,911,237	Y4265*	probably null	Het
Vamp5	G	A	6: 72,380,441		probably benign	Het
Vmn2r12	A	T	5: 109,092,905	L114Q	probably damaging	Het
Vmn2r98	A	T	17: 19,065,801	Y187F	probably benign	Het

Other mutations in Sdk2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00972:Sdk2	APN	11	113854384	missense	possibly damaging	0.86
IGL01063:Sdk2	APN	11	113830842	missense	probably damaging	1.00
IGL01291:Sdk2	APN	11	113843080	missense	probably benign
IGL01316:Sdk2	APN	11	113867965	missense	probably benign	0.09
IGL01614:Sdk2	APN	11	113793858	missense	probably damaging	1.00
IGL01998:Sdk2	APN	11	113838532	missense	probably damaging	0.98
IGL02014:Sdk2	APN	11	113838494	missense	probably damaging	1.00
IGL02095:Sdk2	APN	11	113834830	missense	probably damaging	1.00
IGL02115:Sdk2	APN	11	113834813	splice site	probably benign
IGL02543:Sdk2	APN	11	113868921	missense	possibly damaging	0.90
IGL02976:Sdk2	APN	11	113851842	missense	probably damaging	1.00
IGL03001:Sdk2	APN	11	113821626	missense	probably benign	0.00
IGL03122:Sdk2	APN	11	113842068	missense	probably damaging	1.00
IGL03183:Sdk2	APN	11	113850984	missense	probably benign	0.19
IGL03222:Sdk2	APN	11	113838431	missense	probably benign	0.01
IGL03310:Sdk2	APN	11	113793325	missense	possibly damaging	0.77
ANU05:Sdk2	UTSW	11	113843080	missense	probably benign
R0008:Sdk2	UTSW	11	113856755	missense	probably damaging	1.00
R0008:Sdk2	UTSW	11	113856755	missense	probably damaging	1.00
R0088:Sdk2	UTSW	11	113827086	missense	possibly damaging	0.74
R0096:Sdk2	UTSW	11	113903144	splice site	probably benign
R0386:Sdk2	UTSW	11	113893464	missense	probably damaging	0.96
R0396:Sdk2	UTSW	11	113829967	missense	probably benign	0.04
R0409:Sdk2	UTSW	11	113850891	splice site	probably benign
R0416:Sdk2	UTSW	11	113803203	missense	probably damaging	1.00
R0456:Sdk2	UTSW	11	113791466	missense	possibly damaging	0.93
R0544:Sdk2	UTSW	11	113781010	missense	probably damaging	1.00
R0691:Sdk2	UTSW	11	113794920	splice site	probably null
R0711:Sdk2	UTSW	11	113903144	splice site	probably benign
R0717:Sdk2	UTSW	11	113832326	missense	probably damaging	1.00
R0780:Sdk2	UTSW	11	113893508	missense	probably benign	0.07
R0831:Sdk2	UTSW	11	113832258	missense	probably damaging	0.96
R0853:Sdk2	UTSW	11	113821415	missense	probably benign	0.00
R0865:Sdk2	UTSW	11	113850922	missense	probably benign	0.12
R0930:Sdk2	UTSW	11	113838445	missense	probably benign	0.01
R0964:Sdk2	UTSW	11	113806417	splice site	probably benign
R1051:Sdk2	UTSW	11	113838646	synonymous	silent
R1052:Sdk2	UTSW	11	113838646	synonymous	silent
R1054:Sdk2	UTSW	11	113838646	synonymous	silent
R1055:Sdk2	UTSW	11	113838646	synonymous	silent
R1077:Sdk2	UTSW	11	113838646	synonymous	silent
R1079:Sdk2	UTSW	11	113838646	synonymous	silent
R1115:Sdk2	UTSW	11	113838646	synonymous	silent
R1186:Sdk2	UTSW	11	113838646	synonymous	silent
R1187:Sdk2	UTSW	11	113838646	synonymous	silent
R1337:Sdk2	UTSW	11	113832331	missense	possibly damaging	0.79
R1430:Sdk2	UTSW	11	113838646	synonymous	silent
R1433:Sdk2	UTSW	11	113795045	missense	probably damaging	0.99
R1464:Sdk2	UTSW	11	113830080	missense	possibly damaging	0.86
R1464:Sdk2	UTSW	11	113830080	missense	possibly damaging	0.86
R1497:Sdk2	UTSW	11	113893575	splice site	probably benign
R1514:Sdk2	UTSW	11	113838646	synonymous	silent
R1529:Sdk2	UTSW	11	113838646	synonymous	silent
R1596:Sdk2	UTSW	11	113838609	splice site	probably benign
R1680:Sdk2	UTSW	11	113791436	missense	possibly damaging	0.47
R1680:Sdk2	UTSW	11	113838646	synonymous	silent
R1770:Sdk2	UTSW	11	113793741	missense	probably benign	0.05
R1858:Sdk2	UTSW	11	113838646	synonymous	silent
R1866:Sdk2	UTSW	11	113838646	synonymous	silent
R1874:Sdk2	UTSW	11	113834956	missense	probably benign	0.00
R1899:Sdk2	UTSW	11	113838646	synonymous	silent
R1905:Sdk2	UTSW	11	113838646	synonymous	silent
R1907:Sdk2	UTSW	11	113838646	synonymous	silent
R1913:Sdk2	UTSW	11	113856726	missense	possibly damaging	0.77
R1964:Sdk2	UTSW	11	113781017	nonsense	probably null
R2055:Sdk2	UTSW	11	113850954	missense	probably damaging	1.00
R2059:Sdk2	UTSW	11	113854332	missense	probably damaging	1.00
R2093:Sdk2	UTSW	11	113943122	missense	probably damaging	1.00
R2256:Sdk2	UTSW	11	113830794	missense	probably benign	0.44
R3720:Sdk2	UTSW	11	113800244	missense	probably damaging	1.00
R3795:Sdk2	UTSW	11	113856696	nonsense	probably null
R4037:Sdk2	UTSW	11	113795055	missense	probably damaging	1.00
R4171:Sdk2	UTSW	11	113866989	splice site	probably null
R4717:Sdk2	UTSW	11	113854369	missense	probably damaging	0.96
R4758:Sdk2	UTSW	11	113827054	missense	possibly damaging	0.87
R4857:Sdk2	UTSW	11	113821382	nonsense	probably null
R4924:Sdk2	UTSW	11	113857758	missense	probably damaging	1.00
R5015:Sdk2	UTSW	11	113793761	missense	probably damaging	1.00
R5171:Sdk2	UTSW	11	113850982	missense	probably benign	0.01
R5239:Sdk2	UTSW	11	113868033	missense	probably damaging	1.00
R5243:Sdk2	UTSW	11	113825086	missense	possibly damaging	0.76
R5279:Sdk2	UTSW	11	113867031	missense	probably benign	0.31
R5535:Sdk2	UTSW	11	113943158	missense	possibly damaging	0.80
R5634:Sdk2	UTSW	11	113851714	missense	probably damaging	1.00
R5637:Sdk2	UTSW	11	113833179	missense	probably damaging	1.00
R5726:Sdk2	UTSW	11	113851800	missense	probably damaging	1.00
R5793:Sdk2	UTSW	11	113868952	missense	possibly damaging	0.46
R5798:Sdk2	UTSW	11	113827116	missense	probably damaging	1.00
R5834:Sdk2	UTSW	11	113854273	missense	probably damaging	1.00
R5863:Sdk2	UTSW	11	113834984	missense	probably damaging	0.98
R5869:Sdk2	UTSW	11	113851882	missense	probably damaging	0.96
R5875:Sdk2	UTSW	11	113830059	missense	probably benign	0.00
R5953:Sdk2	UTSW	11	113793744	missense	probably damaging	1.00
R5991:Sdk2	UTSW	11	113943254	missense	probably damaging	0.97
R6018:Sdk2	UTSW	11	113830063	missense	probably benign	0.00
R6116:Sdk2	UTSW	11	113854364	missense	probably damaging	0.99
R6328:Sdk2	UTSW	11	113793755	missense	probably damaging	1.00
R6348:Sdk2	UTSW	11	113893508	missense	probably benign	0.07
R6383:Sdk2	UTSW	11	113832265	missense	probably damaging	1.00
R6824:Sdk2	UTSW	11	113867934	missense	probably benign	0.43
R6835:Sdk2	UTSW	11	113830048	missense	probably damaging	0.98
R6912:Sdk2	UTSW	11	113903120	missense	probably benign	0.03
R7000:Sdk2	UTSW	11	113803169	missense	probably damaging	1.00
R7099:Sdk2	UTSW	11	113834905	missense	probably damaging	0.98
R7102:Sdk2	UTSW	11	113842690	nonsense	probably null
R7177:Sdk2	UTSW	11	113829969	missense	possibly damaging	0.91
R7381:Sdk2	UTSW	11	113838489	missense	probably damaging	0.98
R7412:Sdk2	UTSW	11	113868083	splice site	probably null
R7504:Sdk2	UTSW	11	113867967	missense	possibly damaging	0.50
R7552:Sdk2	UTSW	11	113873213	missense	possibly damaging	0.63
R7604:Sdk2	UTSW	11	113829969	missense	possibly damaging	0.91
R7647:Sdk2	UTSW	11	113793737	missense	probably damaging	1.00
RF002:Sdk2	UTSW	11	113885252	missense	probably benign	0.00
V1662:Sdk2	UTSW	11	113834908	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTTGGGAGGTGAAACGTTG -3'
(R):5'- CCAGAAAGCCCACTCCTTTG -3'

Sequencing Primer
(F):5'- CGGCAAAGGAAGATTTTGGTGTCTC -3'
(R):5'- TTGTCAACCATTACATCAGTGACC -3'

Posted On

2018-09-12