Mutagenetix > Incidental Mutations

Incidental Mutation 'R6853:Msh3'

535106

Institutional Source

Beutler Lab

Gene Symbol

Msh3

Ensembl Gene

ENSMUSG00000014850

Gene Name

mutS homolog 3

Synonyms

Rep3, Rep-3, D13Em1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.315) question?

Stock #

R6853 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

92211872-92355003 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 92312572 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000140002 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022220] [ENSMUST00000185852] [ENSMUST00000187874] [ENSMUST00000191509] [ENSMUST00000191550]

Predicted Effect

probably null
Transcript: ENSMUST00000022220

SMART Domains

Protein: ENSMUSP00000022220
Gene: ENSMUSG00000014850

Domain	Start	End	E-Value	Type
low complexity region	4	19	N/A	INTRINSIC
low complexity region	24	40	N/A	INTRINSIC
Pfam:MutS_I	188	301	1.6e-35	PFAM
Pfam:MutS_II	324	481	2.2e-36	PFAM
MUTSd	513	828	7.62e-97	SMART
MUTSac	847	1049	9.7e-122	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000185852

SMART Domains

Protein: ENSMUSP00000140002
Gene: ENSMUSG00000014850

Domain	Start	End	E-Value	Type
low complexity region	4	19	N/A	INTRINSIC
low complexity region	24	40	N/A	INTRINSIC
Pfam:MutS_I	188	301	7.2e-35	PFAM
Pfam:MutS_II	324	481	2.2e-36	PFAM
MUTSd	513	828	7.62e-97	SMART
MUTSac	847	1049	9.7e-122	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000187874

SMART Domains

Protein: ENSMUSP00000139620
Gene: ENSMUSG00000014850

Domain	Start	End	E-Value	Type
low complexity region	4	19	N/A	INTRINSIC
low complexity region	24	40	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000191509

SMART Domains

Protein: ENSMUSP00000141158
Gene: ENSMUSG00000014850

Domain	Start	End	E-Value	Type
low complexity region	4	19	N/A	INTRINSIC
low complexity region	24	40	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000191550

SMART Domains

Protein: ENSMUSP00000140659
Gene: ENSMUSG00000014850

Domain	Start	End	E-Value	Type
low complexity region	4	19	N/A	INTRINSIC
low complexity region	24	40	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.0%

Validation Efficiency

98% (63/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a heterodimer with MSH2 to form MutS beta, part of the post-replicative DNA mismatch repair system. MutS beta initiates mismatch repair by binding to a mismatch and then forming a complex with MutL alpha heterodimer. This gene contains a polymorphic 9 bp tandem repeat sequence in the first exon. The repeat is present 6 times in the reference genome sequence and 3-7 repeats have been reported. Defects in this gene are a cause of susceptibility to endometrial cancer. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a partial defect mismatch repair and development of intestinal tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6030458C11Rik	G	T	15: 12,817,945	D138E	probably benign	Het
Atp13a5	A	G	16: 29,321,662	S359P	possibly damaging	Het
Bcam	T	C	7: 19,760,406	D355G	probably damaging	Het
Bmp8a	C	A	4: 123,342,683	W9L	unknown	Het
Cacul1	A	T	19: 60,529,466	Y334*	probably null	Het
Ccdc178	A	T	18: 22,109,876	N227K	probably benign	Het
Ceacam2	T	C	7: 25,518,136	N318S	possibly damaging	Het
Cntrl	T	A	2: 35,129,821	S553R	possibly damaging	Het
Ctsa	T	A	2: 164,837,364	M331K	probably benign	Het
Cyp2c38	T	A	19: 39,438,304	Q184H	probably benign	Het
Cyp2c70	C	T	19: 40,183,920	E93K	possibly damaging	Het
D430041D05Rik	C	T	2: 104,241,155	V1267M	probably damaging	Het
Ddias	C	T	7: 92,859,565	A381T	possibly damaging	Het
Dnhd1	G	A	7: 105,703,728	C2696Y	probably benign	Het
Efr3a	G	A	15: 65,829,830	V198I	probably benign	Het
Farp2	T	C	1: 93,570,016	F256S	probably damaging	Het
Fga	A	G	3: 83,030,912	Y198C	probably damaging	Het
Gabpa	T	A	16: 84,860,499	C421S	probably damaging	Het
Gm21798	A	T	15: 64,817,865		probably benign	Het
Gm21798	A	T	15: 64,817,867		probably benign	Het
Gm7145	A	C	1: 117,986,144	N252T	possibly damaging	Het
H2-Q6	T	C	17: 35,428,359	*327R	probably null	Het
H6pd	T	C	4: 149,982,462	D489G	probably benign	Het
Htra2	A	G	6: 83,053,831		probably benign	Het
Ice1	T	G	13: 70,603,302	E1555A	possibly damaging	Het
Inpp5d	T	A	1: 87,681,680		probably null	Het
Itih2	T	C	2: 10,115,266	D320G	probably damaging	Het
Kif1a	T	G	1: 93,039,802	H1129P	possibly damaging	Het
Kmt2a	G	A	9: 44,818,407		probably benign	Het
L3mbtl4	G	A	17: 68,777,920	D609N	probably damaging	Het
Lgals9	A	T	11: 78,966,006	D248E	probably benign	Het
Lhx9	ACC	ACCC	1: 138,841,806		probably null	Het
Mtus2	A	G	5: 148,107,011	K803R	probably damaging	Het
Oas1a	T	A	5: 120,907,428	I17L	possibly damaging	Het
Olfr1480	T	A	19: 13,529,931	I130K	possibly damaging	Het
Olfr178	C	T	16: 58,889,758	S154N	possibly damaging	Het
Olfr178	T	A	16: 58,889,759	S154C	probably damaging	Het
Olfr851	T	G	9: 19,496,806	Y19*	probably null	Het
Olfr92	G	A	17: 37,111,508	T158I	probably benign	Het
Otof	T	C	5: 30,388,239	D539G	probably damaging	Het
Pabpc4	T	C	4: 123,294,743	Y382H	possibly damaging	Het
Rag1	T	C	2: 101,642,221	T859A	probably damaging	Het
Ralbp1	C	T	17: 65,852,756	R504H	possibly damaging	Het
Sdk2	A	G	11: 113,780,929	F2131S	probably damaging	Het
Sik1	A	T	17: 31,854,206		probably null	Het
Sis	A	G	3: 72,891,426	I1763T	possibly damaging	Het
Slc39a6	A	G	18: 24,599,319	I304T	possibly damaging	Het
Slc5a12	A	G	2: 110,624,194	S367G	probably benign	Het
Smchd1	A	T	17: 71,436,743	W476R	probably damaging	Het
Spag17	T	C	3: 100,013,235	Y429H	possibly damaging	Het
Stt3a	G	A	9: 36,741,727	S553F	possibly damaging	Het
Sult2a1	C	T	7: 13,801,487	V214I	possibly damaging	Het
Supt6	T	C	11: 78,232,830	E38G	possibly damaging	Het
Tenm4	G	A	7: 96,837,295	G990R	possibly damaging	Het
Thop1	T	C	10: 81,075,661		probably null	Het
Thumpd2	C	A	17: 81,065,030	D11Y	possibly damaging	Het
Tmf1	T	G	6: 97,168,849	I574L	probably damaging	Het
Tnfaip3	A	G	10: 19,003,751	V623A	probably benign	Het
Ttll3	CAAAGTAA	CAAAGTAAAGTAA	6: 113,399,157		probably null	Het
Ush2a	T	G	1: 188,911,237	Y4265*	probably null	Het
Vamp5	G	A	6: 72,380,441		probably benign	Het
Vmn2r12	A	T	5: 109,092,905	L114Q	probably damaging	Het
Vmn2r98	A	T	17: 19,065,801	Y187F	probably benign	Het

Other mutations in Msh3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00895:Msh3	APN	13	92344964	missense	probably damaging	1.00
IGL00983:Msh3	APN	13	92300277	missense	probably damaging	1.00
IGL01490:Msh3	APN	13	92300305	missense	probably damaging	1.00
IGL02072:Msh3	APN	13	92300295	missense	probably damaging	1.00
IGL02313:Msh3	APN	13	92349312	missense	possibly damaging	0.86
IGL02711:Msh3	APN	13	92351311	missense	probably damaging	1.00
IGL03108:Msh3	APN	13	92221088	splice site	probably benign
IGL03227:Msh3	APN	13	92285960	missense	probably damaging	0.98
R0164:Msh3	UTSW	13	92349209	missense	probably damaging	1.00
R0164:Msh3	UTSW	13	92349209	missense	probably damaging	1.00
R0415:Msh3	UTSW	13	92346786	missense	possibly damaging	0.89
R0457:Msh3	UTSW	13	92220997	missense	probably damaging	1.00
R0659:Msh3	UTSW	13	92345096	missense	possibly damaging	0.80
R0661:Msh3	UTSW	13	92345096	missense	possibly damaging	0.80
R0686:Msh3	UTSW	13	92351431	missense	possibly damaging	0.53
R0688:Msh3	UTSW	13	92351431	missense	possibly damaging	0.53
R0707:Msh3	UTSW	13	92347340	nonsense	probably null
R1605:Msh3	UTSW	13	92300275	missense	probably null	1.00
R1622:Msh3	UTSW	13	92344954	critical splice donor site	probably null
R1771:Msh3	UTSW	13	92212496	missense	probably benign	0.05
R1970:Msh3	UTSW	13	92249820	splice site	probably benign
R1971:Msh3	UTSW	13	92223276	missense	probably damaging	1.00
R1971:Msh3	UTSW	13	92249820	splice site	probably benign
R2894:Msh3	UTSW	13	92342360	missense	probably benign	0.16
R3837:Msh3	UTSW	13	92354858	missense	probably damaging	1.00
R4119:Msh3	UTSW	13	92354011	intron	probably benign
R4225:Msh3	UTSW	13	92285923	missense	probably benign	0.03
R4881:Msh3	UTSW	13	92266041	intron	probably benign
R5118:Msh3	UTSW	13	92309434	splice site	probably benign
R5209:Msh3	UTSW	13	92344954	critical splice donor site	probably null
R5817:Msh3	UTSW	13	92286000	missense	possibly damaging	0.86
R5849:Msh3	UTSW	13	92249878	missense	possibly damaging	0.81
R5851:Msh3	UTSW	13	92215522	missense	probably benign	0.00
R5940:Msh3	UTSW	13	92249843	missense	probably damaging	1.00
R6004:Msh3	UTSW	13	92342414	critical splice acceptor site	probably null
R6363:Msh3	UTSW	13	92212524	missense	probably damaging	1.00
R6510:Msh3	UTSW	13	92353264	nonsense	probably null
R6654:Msh3	UTSW	13	92345042	missense	probably benign	0.01
R7022:Msh3	UTSW	13	92235588	missense	probably damaging	1.00
R7098:Msh3	UTSW	13	92274111	missense	possibly damaging	0.95
R7103:Msh3	UTSW	13	92274800	missense	probably benign
R7148:Msh3	UTSW	13	92354822	missense	probably benign	0.18
R7171:Msh3	UTSW	13	92349298	missense	probably benign	0.00
R7317:Msh3	UTSW	13	92286004	missense	probably damaging	1.00
R7369:Msh3	UTSW	13	92299262	missense	probably benign	0.15
R7641:Msh3	UTSW	13	92212503	missense	probably benign	0.08
R7648:Msh3	UTSW	13	92274028	missense	probably damaging	1.00
R7674:Msh3	UTSW	13	92212503	missense	probably benign	0.08
S24628:Msh3	UTSW	13	92346786	missense	possibly damaging	0.89
X0027:Msh3	UTSW	13	92274070	missense	probably damaging	0.98
X0063:Msh3	UTSW	13	92274785	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TCATGCTGCTGGTGTTCTCT -3'
(R):5'- TGTTGTTATTCAAGGCTGACATCT -3'

Sequencing Primer
(F):5'- CTTCTGAGCACTGGGTGAACAG -3'
(R):5'- GGATGACAGGATTCGAGT -3'

Posted On

2018-09-12