Incidental Mutation 'R6853:Or2h2c'
ID 535118
Institutional Source Beutler Lab
Gene Symbol Or2h2c
Ensembl Gene ENSMUSG00000096477
Gene Name olfactory receptor family 2 subfamily H member 2C
Synonyms MOR256-29, Olfr92, GA_x6K02T2PSCP-1552066-1551128
MMRRC Submission 044956-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.069) question?
Stock # R6853 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 37421934-37422872 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 37422400 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 158 (T158I)
Ref Sequence ENSEMBL: ENSMUSP00000150988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168659] [ENSMUST00000214994] [ENSMUST00000216341]
AlphaFold L7N475
Predicted Effect probably benign
Transcript: ENSMUST00000168659
AA Change: T158I

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000128393
Gene: ENSMUSG00000096477
AA Change: T158I

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srv 23 304 5.1e-7 PFAM
Pfam:7tm_4 29 306 3.4e-50 PFAM
Pfam:7tm_1 39 288 1.1e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214994
AA Change: T158I

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000216341
AA Change: T158I

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030458C11Rik G T 15: 12,818,031 (GRCm39) D138E probably benign Het
Atp13a5 A G 16: 29,140,480 (GRCm39) S359P possibly damaging Het
Bcam T C 7: 19,494,331 (GRCm39) D355G probably damaging Het
Bmp8a C A 4: 123,236,476 (GRCm39) W9L unknown Het
Cacul1 A T 19: 60,517,904 (GRCm39) Y334* probably null Het
Ccdc178 A T 18: 22,242,933 (GRCm39) N227K probably benign Het
Ceacam2 T C 7: 25,217,561 (GRCm39) N318S possibly damaging Het
Cntrl T A 2: 35,019,833 (GRCm39) S553R possibly damaging Het
Ctsa T A 2: 164,679,284 (GRCm39) M331K probably benign Het
Cyp2c38 T A 19: 39,426,748 (GRCm39) Q184H probably benign Het
Cyp2c70 C T 19: 40,172,364 (GRCm39) E93K possibly damaging Het
D430041D05Rik C T 2: 104,071,500 (GRCm39) V1267M probably damaging Het
Ddias C T 7: 92,508,773 (GRCm39) A381T possibly damaging Het
Dnhd1 G A 7: 105,352,935 (GRCm39) C2696Y probably benign Het
Efr3a G A 15: 65,701,679 (GRCm39) V198I probably benign Het
Farp2 T C 1: 93,497,738 (GRCm39) F256S probably damaging Het
Fga A G 3: 82,938,219 (GRCm39) Y198C probably damaging Het
Gabpa T A 16: 84,657,387 (GRCm39) C421S probably damaging Het
Gm21798 A T 15: 64,689,714 (GRCm39) probably benign Het
Gm21798 A T 15: 64,689,716 (GRCm39) probably benign Het
Gm7145 A C 1: 117,913,874 (GRCm39) N252T possibly damaging Het
H2-Q6 T C 17: 35,647,335 (GRCm39) *327R probably null Het
H6pd T C 4: 150,066,919 (GRCm39) D489G probably benign Het
Htra2 A G 6: 83,030,812 (GRCm39) probably benign Het
Ice1 T G 13: 70,751,421 (GRCm39) E1555A possibly damaging Het
Inpp5d T A 1: 87,609,402 (GRCm39) probably null Het
Itih2 T C 2: 10,120,077 (GRCm39) D320G probably damaging Het
Kif1a T G 1: 92,967,524 (GRCm39) H1129P possibly damaging Het
Kmt2a G A 9: 44,729,704 (GRCm39) probably benign Het
L3mbtl4 G A 17: 69,084,915 (GRCm39) D609N probably damaging Het
Lgals9 A T 11: 78,856,832 (GRCm39) D248E probably benign Het
Lhx9 ACC ACCC 1: 138,769,544 (GRCm39) probably null Het
Msh3 A G 13: 92,449,080 (GRCm39) probably null Het
Mtus2 A G 5: 148,043,821 (GRCm39) K803R probably damaging Het
Oas1a T A 5: 121,045,491 (GRCm39) I17L possibly damaging Het
Or5b121 T A 19: 13,507,295 (GRCm39) I130K possibly damaging Het
Or5k15 C T 16: 58,710,121 (GRCm39) S154N possibly damaging Het
Or5k15 T A 16: 58,710,122 (GRCm39) S154C probably damaging Het
Or7g32 T G 9: 19,408,102 (GRCm39) Y19* probably null Het
Otof T C 5: 30,545,583 (GRCm39) D539G probably damaging Het
Pabpc4 T C 4: 123,188,536 (GRCm39) Y382H possibly damaging Het
Rag1 T C 2: 101,472,566 (GRCm39) T859A probably damaging Het
Ralbp1 C T 17: 66,159,751 (GRCm39) R504H possibly damaging Het
Sdk2 A G 11: 113,671,755 (GRCm39) F2131S probably damaging Het
Sik1 A T 17: 32,073,180 (GRCm39) probably null Het
Sis A G 3: 72,798,759 (GRCm39) I1763T possibly damaging Het
Slc39a6 A G 18: 24,732,376 (GRCm39) I304T possibly damaging Het
Slc5a12 A G 2: 110,454,539 (GRCm39) S367G probably benign Het
Smchd1 A T 17: 71,743,738 (GRCm39) W476R probably damaging Het
Spag17 T C 3: 99,920,551 (GRCm39) Y429H possibly damaging Het
Stt3a G A 9: 36,653,023 (GRCm39) S553F possibly damaging Het
Sult2a1 C T 7: 13,535,412 (GRCm39) V214I possibly damaging Het
Supt6 T C 11: 78,123,656 (GRCm39) E38G possibly damaging Het
Tenm4 G A 7: 96,486,502 (GRCm39) G990R possibly damaging Het
Thop1 T C 10: 80,911,495 (GRCm39) probably null Het
Thumpd2 C A 17: 81,372,459 (GRCm39) D11Y possibly damaging Het
Tmf1 T G 6: 97,145,810 (GRCm39) I574L probably damaging Het
Tnfaip3 A G 10: 18,879,499 (GRCm39) V623A probably benign Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,376,118 (GRCm39) probably null Het
Ush2a T G 1: 188,643,434 (GRCm39) Y4265* probably null Het
Vamp5 G A 6: 72,357,424 (GRCm39) probably benign Het
Vmn2r12 A T 5: 109,240,771 (GRCm39) L114Q probably damaging Het
Vmn2r98 A T 17: 19,286,063 (GRCm39) Y187F probably benign Het
Other mutations in Or2h2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01527:Or2h2c APN 17 37,422,701 (GRCm39) missense probably damaging 1.00
IGL02850:Or2h2c APN 17 37,422,865 (GRCm39) missense probably benign 0.35
IGL03209:Or2h2c APN 17 37,422,413 (GRCm39) missense probably benign 0.04
R0579:Or2h2c UTSW 17 37,422,347 (GRCm39) missense probably benign 0.00
R0580:Or2h2c UTSW 17 37,422,347 (GRCm39) missense probably benign 0.00
R0582:Or2h2c UTSW 17 37,422,347 (GRCm39) missense probably benign 0.00
R0615:Or2h2c UTSW 17 37,422,347 (GRCm39) missense probably benign 0.00
R0669:Or2h2c UTSW 17 37,422,347 (GRCm39) missense probably benign 0.00
R0674:Or2h2c UTSW 17 37,422,347 (GRCm39) missense probably benign 0.00
R0675:Or2h2c UTSW 17 37,422,347 (GRCm39) missense probably benign 0.00
R2424:Or2h2c UTSW 17 37,422,408 (GRCm39) missense probably benign 0.02
R3714:Or2h2c UTSW 17 37,422,227 (GRCm39) missense probably damaging 1.00
R4393:Or2h2c UTSW 17 37,424,971 (GRCm39) intron probably benign
R5811:Or2h2c UTSW 17 37,422,649 (GRCm39) missense probably benign 0.00
R6615:Or2h2c UTSW 17 37,422,494 (GRCm39) missense probably damaging 1.00
R6876:Or2h2c UTSW 17 37,422,098 (GRCm39) missense probably damaging 1.00
R7665:Or2h2c UTSW 17 37,422,283 (GRCm39) missense probably benign 0.20
R8087:Or2h2c UTSW 17 37,422,440 (GRCm39) missense probably benign
R9224:Or2h2c UTSW 17 37,422,767 (GRCm39) missense possibly damaging 0.53
R9439:Or2h2c UTSW 17 37,422,205 (GRCm39) missense probably damaging 1.00
R9541:Or2h2c UTSW 17 37,422,824 (GRCm39) missense probably benign 0.00
R9559:Or2h2c UTSW 17 37,422,509 (GRCm39) missense possibly damaging 0.84
Z1177:Or2h2c UTSW 17 37,422,322 (GRCm39) missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TCCCAAAAGCTTTCCTGCG -3'
(R):5'- CATGTCCCTGGGTACAACAG -3'

Sequencing Primer
(F):5'- TGCAGAGCTTATCTTCAGCAC -3'
(R):5'- AGAGTGCATCCTCCTGACTGTAATG -3'
Posted On 2018-09-12