Incidental Mutation 'R6853:Slc39a6'
ID535124
Institutional Source Beutler Lab
Gene Symbol Slc39a6
Ensembl Gene ENSMUSG00000024270
Gene Namesolute carrier family 39 (metal ion transporter), member 6
SynonymsErmelin
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.261) question?
Stock #R6853 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location24579881-24603817 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24599319 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 304 (I304T)
Ref Sequence ENSEMBL: ENSMUSP00000064667 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025120] [ENSMUST00000070726] [ENSMUST00000152504] [ENSMUST00000154205]
Predicted Effect probably benign
Transcript: ENSMUST00000025120
SMART Domains Protein: ENSMUSP00000025120
Gene: ENSMUSG00000024271

DomainStartEndE-ValueType
WD40 47 91 1.06e-3 SMART
WD40 94 143 2.24e-2 SMART
WD40 196 237 4.69e-5 SMART
WD40 271 319 2.44e-3 SMART
Blast:WD40 329 368 1e-20 BLAST
WD40 376 415 2.12e-3 SMART
WD40 429 467 1.71e1 SMART
WD40 556 600 7.43e-1 SMART
WD40 603 642 1.93e-6 SMART
WD40 661 697 1.55e-5 SMART
Blast:WD40 709 753 7e-21 BLAST
WD40 766 825 1.92e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000070726
AA Change: I304T

PolyPhen 2 Score 0.714 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000064667
Gene: ENSMUSG00000024270
AA Change: I304T

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 94 141 N/A INTRINSIC
low complexity region 187 198 N/A INTRINSIC
Pfam:Zip 332 753 3e-104 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152504
Predicted Effect probably benign
Transcript: ENSMUST00000154205
AA Change: I20T

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000122151
Gene: ENSMUSG00000024270
AA Change: I20T

DomainStartEndE-ValueType
Pfam:Zip 48 433 2e-94 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc is an essential cofactor for hundreds of enzymes. It is involved in protein, nucleic acid, carbohydrate, and lipid metabolism, as well as in the control of gene transcription, growth, development, and differentiation. SLC39A6 belongs to a subfamily of proteins that show structural characteristics of zinc transporters (Taylor and Nicholson, 2003 [PubMed 12659941]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele do not display any gross skin abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030458C11Rik G T 15: 12,817,945 D138E probably benign Het
Atp13a5 A G 16: 29,321,662 S359P possibly damaging Het
Bcam T C 7: 19,760,406 D355G probably damaging Het
Bmp8a C A 4: 123,342,683 W9L unknown Het
Cacul1 A T 19: 60,529,466 Y334* probably null Het
Ccdc178 A T 18: 22,109,876 N227K probably benign Het
Ceacam2 T C 7: 25,518,136 N318S possibly damaging Het
Cntrl T A 2: 35,129,821 S553R possibly damaging Het
Ctsa T A 2: 164,837,364 M331K probably benign Het
Cyp2c38 T A 19: 39,438,304 Q184H probably benign Het
Cyp2c70 C T 19: 40,183,920 E93K possibly damaging Het
D430041D05Rik C T 2: 104,241,155 V1267M probably damaging Het
Ddias C T 7: 92,859,565 A381T possibly damaging Het
Dnhd1 G A 7: 105,703,728 C2696Y probably benign Het
Efr3a G A 15: 65,829,830 V198I probably benign Het
Farp2 T C 1: 93,570,016 F256S probably damaging Het
Fga A G 3: 83,030,912 Y198C probably damaging Het
Gabpa T A 16: 84,860,499 C421S probably damaging Het
Gm21798 A T 15: 64,817,865 probably benign Het
Gm21798 A T 15: 64,817,867 probably benign Het
Gm7145 A C 1: 117,986,144 N252T possibly damaging Het
H2-Q6 T C 17: 35,428,359 *327R probably null Het
H6pd T C 4: 149,982,462 D489G probably benign Het
Htra2 A G 6: 83,053,831 probably benign Het
Ice1 T G 13: 70,603,302 E1555A possibly damaging Het
Inpp5d T A 1: 87,681,680 probably null Het
Itih2 T C 2: 10,115,266 D320G probably damaging Het
Kif1a T G 1: 93,039,802 H1129P possibly damaging Het
Kmt2a G A 9: 44,818,407 probably benign Het
L3mbtl4 G A 17: 68,777,920 D609N probably damaging Het
Lgals9 A T 11: 78,966,006 D248E probably benign Het
Lhx9 ACC ACCC 1: 138,841,806 probably null Het
Msh3 A G 13: 92,312,572 probably null Het
Mtus2 A G 5: 148,107,011 K803R probably damaging Het
Oas1a T A 5: 120,907,428 I17L possibly damaging Het
Olfr1480 T A 19: 13,529,931 I130K possibly damaging Het
Olfr178 C T 16: 58,889,758 S154N possibly damaging Het
Olfr178 T A 16: 58,889,759 S154C probably damaging Het
Olfr851 T G 9: 19,496,806 Y19* probably null Het
Olfr92 G A 17: 37,111,508 T158I probably benign Het
Otof T C 5: 30,388,239 D539G probably damaging Het
Pabpc4 T C 4: 123,294,743 Y382H possibly damaging Het
Rag1 T C 2: 101,642,221 T859A probably damaging Het
Ralbp1 C T 17: 65,852,756 R504H possibly damaging Het
Sdk2 A G 11: 113,780,929 F2131S probably damaging Het
Sik1 A T 17: 31,854,206 probably null Het
Sis A G 3: 72,891,426 I1763T possibly damaging Het
Slc5a12 A G 2: 110,624,194 S367G probably benign Het
Smchd1 A T 17: 71,436,743 W476R probably damaging Het
Spag17 T C 3: 100,013,235 Y429H possibly damaging Het
Stt3a G A 9: 36,741,727 S553F possibly damaging Het
Sult2a1 C T 7: 13,801,487 V214I possibly damaging Het
Supt6 T C 11: 78,232,830 E38G possibly damaging Het
Tenm4 G A 7: 96,837,295 G990R possibly damaging Het
Thop1 T C 10: 81,075,661 probably null Het
Thumpd2 C A 17: 81,065,030 D11Y possibly damaging Het
Tmf1 T G 6: 97,168,849 I574L probably damaging Het
Tnfaip3 A G 10: 19,003,751 V623A probably benign Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Ush2a T G 1: 188,911,237 Y4265* probably null Het
Vamp5 G A 6: 72,380,441 probably benign Het
Vmn2r12 A T 5: 109,092,905 L114Q probably damaging Het
Vmn2r98 A T 17: 19,065,801 Y187F probably benign Het
Other mutations in Slc39a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Slc39a6 APN 18 24589745 critical splice donor site probably null
IGL01412:Slc39a6 APN 18 24585356 missense probably damaging 1.00
IGL02182:Slc39a6 APN 18 24601290 missense probably damaging 0.99
IGL02332:Slc39a6 APN 18 24589823 missense probably benign 0.22
IGL02648:Slc39a6 APN 18 24582367 missense probably damaging 1.00
R0066:Slc39a6 UTSW 18 24599269 missense probably damaging 1.00
R0066:Slc39a6 UTSW 18 24599269 missense probably damaging 1.00
R0729:Slc39a6 UTSW 18 24601470 missense probably benign 0.00
R1128:Slc39a6 UTSW 18 24585292 missense probably damaging 1.00
R1621:Slc39a6 UTSW 18 24600889 missense probably benign 0.08
R1799:Slc39a6 UTSW 18 24585467 missense probably benign 0.00
R1800:Slc39a6 UTSW 18 24585202 missense probably damaging 1.00
R1885:Slc39a6 UTSW 18 24601482 unclassified probably null
R4159:Slc39a6 UTSW 18 24597828 missense possibly damaging 0.88
R4809:Slc39a6 UTSW 18 24585474 nonsense probably null
R4903:Slc39a6 UTSW 18 24597868 missense probably damaging 1.00
R4994:Slc39a6 UTSW 18 24596294 missense probably damaging 1.00
R5352:Slc39a6 UTSW 18 24601036 missense probably benign 0.00
R5398:Slc39a6 UTSW 18 24597879 missense probably damaging 1.00
R5832:Slc39a6 UTSW 18 24601612 missense possibly damaging 0.81
R6182:Slc39a6 UTSW 18 24600956 missense probably benign 0.16
R7226:Slc39a6 UTSW 18 24584027 missense probably damaging 1.00
R7252:Slc39a6 UTSW 18 24601385 missense possibly damaging 0.64
R7263:Slc39a6 UTSW 18 24601203 missense probably benign
R7328:Slc39a6 UTSW 18 24600930 missense probably benign 0.00
R7388:Slc39a6 UTSW 18 24584049 missense probably damaging 1.00
R7395:Slc39a6 UTSW 18 24585275 missense probably damaging 1.00
X0065:Slc39a6 UTSW 18 24585375 missense possibly damaging 0.95
Z1176:Slc39a6 UTSW 18 24585315 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACATTGTATCTAGAGCGACAATG -3'
(R):5'- AAGCAGAGCTGATTTTAACTGGC -3'

Sequencing Primer
(F):5'- TCTAGAGCGACAATGAAAAATAGTC -3'
(R):5'- CTTTAGTGAGTAAAGGTGATGAGTC -3'
Posted On2018-09-12