Incidental Mutation 'R6853:Cyp2c70'
ID535127
Institutional Source Beutler Lab
Gene Symbol Cyp2c70
Ensembl Gene ENSMUSG00000060613
Gene Namecytochrome P450, family 2, subfamily c, polypeptide 70
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R6853 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location40153353-40187333 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 40183920 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 93 (E93K)
Ref Sequence ENSEMBL: ENSMUSP00000060584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051846] [ENSMUST00000165102] [ENSMUST00000171604]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051846
AA Change: E93K

PolyPhen 2 Score 0.718 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000060584
Gene: ENSMUSG00000060613
AA Change: E93K

DomainStartEndE-ValueType
Pfam:p450 30 486 2.1e-158 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165102
SMART Domains Protein: ENSMUSP00000128691
Gene: ENSMUSG00000060613

DomainStartEndE-ValueType
PDB:4GQS|D 25 54 4e-12 PDB
SCOP:d1cpt__ 26 54 7e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171604
SMART Domains Protein: ENSMUSP00000129063
Gene: ENSMUSG00000060613

DomainStartEndE-ValueType
PDB:4GQS|D 25 50 4e-10 PDB
SCOP:d1cpt__ 26 54 2e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 98% (63/64)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030458C11Rik G T 15: 12,817,945 D138E probably benign Het
Atp13a5 A G 16: 29,321,662 S359P possibly damaging Het
Bcam T C 7: 19,760,406 D355G probably damaging Het
Bmp8a C A 4: 123,342,683 W9L unknown Het
Cacul1 A T 19: 60,529,466 Y334* probably null Het
Ccdc178 A T 18: 22,109,876 N227K probably benign Het
Ceacam2 T C 7: 25,518,136 N318S possibly damaging Het
Cntrl T A 2: 35,129,821 S553R possibly damaging Het
Ctsa T A 2: 164,837,364 M331K probably benign Het
Cyp2c38 T A 19: 39,438,304 Q184H probably benign Het
D430041D05Rik C T 2: 104,241,155 V1267M probably damaging Het
Ddias C T 7: 92,859,565 A381T possibly damaging Het
Dnhd1 G A 7: 105,703,728 C2696Y probably benign Het
Efr3a G A 15: 65,829,830 V198I probably benign Het
Farp2 T C 1: 93,570,016 F256S probably damaging Het
Fga A G 3: 83,030,912 Y198C probably damaging Het
Gabpa T A 16: 84,860,499 C421S probably damaging Het
Gm21798 A T 15: 64,817,865 probably benign Het
Gm21798 A T 15: 64,817,867 probably benign Het
Gm7145 A C 1: 117,986,144 N252T possibly damaging Het
H2-Q6 T C 17: 35,428,359 *327R probably null Het
H6pd T C 4: 149,982,462 D489G probably benign Het
Htra2 A G 6: 83,053,831 probably benign Het
Ice1 T G 13: 70,603,302 E1555A possibly damaging Het
Inpp5d T A 1: 87,681,680 probably null Het
Itih2 T C 2: 10,115,266 D320G probably damaging Het
Kif1a T G 1: 93,039,802 H1129P possibly damaging Het
Kmt2a G A 9: 44,818,407 probably benign Het
L3mbtl4 G A 17: 68,777,920 D609N probably damaging Het
Lgals9 A T 11: 78,966,006 D248E probably benign Het
Lhx9 ACC ACCC 1: 138,841,806 probably null Het
Msh3 A G 13: 92,312,572 probably null Het
Mtus2 A G 5: 148,107,011 K803R probably damaging Het
Oas1a T A 5: 120,907,428 I17L possibly damaging Het
Olfr1480 T A 19: 13,529,931 I130K possibly damaging Het
Olfr178 C T 16: 58,889,758 S154N possibly damaging Het
Olfr178 T A 16: 58,889,759 S154C probably damaging Het
Olfr851 T G 9: 19,496,806 Y19* probably null Het
Olfr92 G A 17: 37,111,508 T158I probably benign Het
Otof T C 5: 30,388,239 D539G probably damaging Het
Pabpc4 T C 4: 123,294,743 Y382H possibly damaging Het
Rag1 T C 2: 101,642,221 T859A probably damaging Het
Ralbp1 C T 17: 65,852,756 R504H possibly damaging Het
Sdk2 A G 11: 113,780,929 F2131S probably damaging Het
Sik1 A T 17: 31,854,206 probably null Het
Sis A G 3: 72,891,426 I1763T possibly damaging Het
Slc39a6 A G 18: 24,599,319 I304T possibly damaging Het
Slc5a12 A G 2: 110,624,194 S367G probably benign Het
Smchd1 A T 17: 71,436,743 W476R probably damaging Het
Spag17 T C 3: 100,013,235 Y429H possibly damaging Het
Stt3a G A 9: 36,741,727 S553F possibly damaging Het
Sult2a1 C T 7: 13,801,487 V214I possibly damaging Het
Supt6 T C 11: 78,232,830 E38G possibly damaging Het
Tenm4 G A 7: 96,837,295 G990R possibly damaging Het
Thop1 T C 10: 81,075,661 probably null Het
Thumpd2 C A 17: 81,065,030 D11Y possibly damaging Het
Tmf1 T G 6: 97,168,849 I574L probably damaging Het
Tnfaip3 A G 10: 19,003,751 V623A probably benign Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Ush2a T G 1: 188,911,237 Y4265* probably null Het
Vamp5 G A 6: 72,380,441 probably benign Het
Vmn2r12 A T 5: 109,092,905 L114Q probably damaging Het
Vmn2r98 A T 17: 19,065,801 Y187F probably benign Het
Other mutations in Cyp2c70
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Cyp2c70 APN 19 40156826 missense probably benign 0.00
IGL00335:Cyp2c70 APN 19 40167576 missense probably damaging 1.00
IGL01966:Cyp2c70 APN 19 40153572 utr 3 prime probably benign
PIT4468001:Cyp2c70 UTSW 19 40165362 missense probably damaging 1.00
R0012:Cyp2c70 UTSW 19 40187243 missense probably null 1.00
R0044:Cyp2c70 UTSW 19 40165371 missense possibly damaging 0.85
R0309:Cyp2c70 UTSW 19 40160671 missense possibly damaging 0.94
R1572:Cyp2c70 UTSW 19 40183982 missense probably benign 0.21
R1650:Cyp2c70 UTSW 19 40165477 missense probably benign 0.00
R1671:Cyp2c70 UTSW 19 40153637 missense probably damaging 1.00
R2016:Cyp2c70 UTSW 19 40164412 missense possibly damaging 0.94
R2163:Cyp2c70 UTSW 19 40160719 missense possibly damaging 0.64
R3425:Cyp2c70 UTSW 19 40184024 missense probably damaging 1.00
R4299:Cyp2c70 UTSW 19 40183928 missense probably benign 0.00
R5037:Cyp2c70 UTSW 19 40183997 missense possibly damaging 0.72
R5103:Cyp2c70 UTSW 19 40160632 missense probably damaging 0.96
R6060:Cyp2c70 UTSW 19 40165413 nonsense probably null
R6440:Cyp2c70 UTSW 19 40156806 missense possibly damaging 0.64
R6936:Cyp2c70 UTSW 19 40167563 missense probably damaging 0.97
R7098:Cyp2c70 UTSW 19 40180487 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AAGTGTGTCTCATGTGCCATCTTTAG -3'
(R):5'- CCAGTGTAGGGGAATGCTAG -3'

Sequencing Primer
(F):5'- CATGTGCCATCTTTAGATTGTTCTG -3'
(R):5'- CAACCTCACAGAAGCAGGGG -3'
Posted On2018-09-12