Incidental Mutation 'R6854:Phyhd1'
ID535131
Institutional Source Beutler Lab
Gene Symbol Phyhd1
Ensembl Gene ENSMUSG00000079484
Gene Namephytanoyl-CoA dioxygenase domain containing 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.262) question?
Stock #R6854 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location30266203-30282149 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 30269761 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 36 (I36L)
Ref Sequence ENSEMBL: ENSMUSP00000121995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091132] [ENSMUST00000113643] [ENSMUST00000113645] [ENSMUST00000127689] [ENSMUST00000133877] [ENSMUST00000138254] [ENSMUST00000139454] [ENSMUST00000139719] [ENSMUST00000150695] [ENSMUST00000154647]
Predicted Effect probably benign
Transcript: ENSMUST00000091132
AA Change: I56L

PolyPhen 2 Score 0.249 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000088663
Gene: ENSMUSG00000079484
AA Change: I56L

DomainStartEndE-ValueType
Pfam:PhyH 32 279 2.7e-72 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113643
AA Change: I36L

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000109273
Gene: ENSMUSG00000079484
AA Change: I36L

DomainStartEndE-ValueType
Pfam:PhyH 12 238 9e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113645
AA Change: I36L

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000109275
Gene: ENSMUSG00000079484
AA Change: I36L

DomainStartEndE-ValueType
Pfam:PhyH 12 259 1.4e-73 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000127689
AA Change: I36L

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000119543
Gene: ENSMUSG00000079484
AA Change: I36L

DomainStartEndE-ValueType
Pfam:PhyH 12 150 7.5e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000133877
AA Change: I32L

PolyPhen 2 Score 0.558 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000117643
Gene: ENSMUSG00000079484
AA Change: I32L

DomainStartEndE-ValueType
Pfam:PhyH 8 249 9.3e-70 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000138254
AA Change: I36L

PolyPhen 2 Score 0.589 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000116062
Gene: ENSMUSG00000079484
AA Change: I36L

DomainStartEndE-ValueType
Pfam:PhyH 12 157 2.2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139454
SMART Domains Protein: ENSMUSP00000139038
Gene: ENSMUSG00000099041

DomainStartEndE-ValueType
Pfam:DUF3733 1 65 3.3e-32 PFAM
Pfam:DUF3733 97 156 2e-22 PFAM
transmembrane domain 320 342 N/A INTRINSIC
low complexity region 445 455 N/A INTRINSIC
internal_repeat_1 461 526 7.6e-5 PROSPERO
low complexity region 540 558 N/A INTRINSIC
LRR 590 613 5.41e0 SMART
LRR 614 636 3.18e2 SMART
LRR 638 660 6.78e1 SMART
LRR_TYP 661 684 1.06e-4 SMART
LRR 685 706 1.15e1 SMART
LRR_TYP 707 730 1.92e-2 SMART
LRR 731 751 1.81e2 SMART
LRR 753 776 2.02e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139719
AA Change: I36L

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000116450
Gene: ENSMUSG00000079484
AA Change: I36L

DomainStartEndE-ValueType
Pfam:PhyH 12 217 4.5e-57 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000150695
AA Change: I36L

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000121995
Gene: ENSMUSG00000079484
AA Change: I36L

DomainStartEndE-ValueType
Pfam:PhyH 12 107 1.1e-16 PFAM
Pfam:PhyH 104 212 7.2e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154647
AA Change: I36L

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000121371
Gene: ENSMUSG00000079484
AA Change: I36L

DomainStartEndE-ValueType
Pfam:PhyH 12 259 1.4e-73 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T C 19: 9,015,235 S4628P probably damaging Het
Aspm G A 1: 139,463,182 R735H possibly damaging Het
Atp4a T C 7: 30,715,008 V152A probably benign Het
BC035947 G A 1: 78,498,488 T469I probably damaging Het
Bicra A T 7: 15,988,762 S277T probably benign Het
Catsperg1 A T 7: 29,181,702 N1142K possibly damaging Het
Ccnd3 T C 17: 47,578,720 probably benign Het
Cdc25a A G 9: 109,879,927 K79E probably damaging Het
Cfap44 A G 16: 44,449,028 probably null Het
Chd5 C A 4: 152,382,938 N1644K probably damaging Het
Flrt3 C T 2: 140,660,718 R330H probably damaging Het
Gm6034 T A 17: 36,057,218 probably null Het
Hivep1 A G 13: 42,156,507 E741G probably damaging Het
Iqgap3 T C 3: 88,096,951 V448A probably damaging Het
Itsn2 A G 12: 4,652,382 R679G probably benign Het
Klrb1c A G 6: 128,788,418 S70P possibly damaging Het
Maml2 C T 9: 13,705,835 T159I possibly damaging Het
Mroh2a G A 1: 88,243,950 R770Q probably damaging Het
Mycl G A 4: 123,000,246 D280N probably damaging Het
Nlrp1b G A 11: 71,228,433 T12I possibly damaging Het
Olfr1315-ps1 T C 2: 112,110,647 N202D probably benign Het
Olfr187 A C 16: 59,036,065 I224S possibly damaging Het
Palmd A G 3: 116,923,463 S462P probably benign Het
Plcd1 T C 9: 119,074,321 probably null Het
Pml G C 9: 58,219,906 A806G probably damaging Het
Ppp6r1 C A 7: 4,632,396 A838S probably benign Het
Pqlc3 G A 12: 16,999,829 L43F probably damaging Het
Prkdc C T 16: 15,651,538 T169I probably damaging Het
Prr23a1 G T 9: 98,842,935 V117L possibly damaging Het
Pus7 T C 5: 23,768,847 silent Het
Rdh7 T C 10: 127,888,381 E78G probably benign Het
Repin1 G T 6: 48,593,891 probably benign Het
Rptn A G 3: 93,398,123 N921S possibly damaging Het
Sema4f A G 6: 82,918,002 L404P probably damaging Het
Serinc4 T A 2: 121,456,550 M2L probably benign Het
Siglecf T C 7: 43,352,180 V138A probably benign Het
Speer2 T A 16: 69,858,887 Q106L probably damaging Het
Sptb G A 12: 76,603,480 P1821L probably damaging Het
St3gal3 C A 4: 117,958,530 M107I probably benign Het
Tmem25 T C 9: 44,796,008 K265E possibly damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Vsig10 G A 5: 117,338,407 V309I probably benign Het
Zfp318 G GAAGAAA 17: 46,412,542 probably benign Het
Other mutations in Phyhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0271:Phyhd1 UTSW 2 30269822 missense probably benign 0.02
R0525:Phyhd1 UTSW 2 30281028 missense probably damaging 1.00
R0665:Phyhd1 UTSW 2 30281028 missense probably damaging 1.00
R1555:Phyhd1 UTSW 2 30274706 missense probably damaging 1.00
R5568:Phyhd1 UTSW 2 30277010 missense probably damaging 1.00
R5714:Phyhd1 UTSW 2 30279982 missense probably damaging 1.00
R5763:Phyhd1 UTSW 2 30279971 missense probably damaging 1.00
R6334:Phyhd1 UTSW 2 30274724 critical splice donor site probably null
R7792:Phyhd1 UTSW 2 30266770 start codon destroyed probably null
Predicted Primers PCR Primer
(F):5'- TACTGACGGCTCCTCACTAAG -3'
(R):5'- TCCCTTGTCAGAAGTCTGTGTG -3'

Sequencing Primer
(F):5'- GCTCCTCACTAAGCACTGGATG -3'
(R):5'- TGTGGCCTTAGGGTCCTCC -3'
Posted On2018-09-12