Incidental Mutation 'R6854:St3gal3'
ID535138
Institutional Source Beutler Lab
Gene Symbol St3gal3
Ensembl Gene ENSMUSG00000028538
Gene NameST3 beta-galactoside alpha-2,3-sialyltransferase 3
SynonymsSiat6, Siat3, ST3Gal III
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6854 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location117932154-118134914 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 117958530 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 107 (M107I)
Ref Sequence ENSEMBL: ENSMUSP00000121051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030263] [ENSMUST00000097912] [ENSMUST00000106410] [ENSMUST00000126336]
Predicted Effect probably benign
Transcript: ENSMUST00000030263
AA Change: M213I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000030263
Gene: ENSMUSG00000028538
AA Change: M213I

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
low complexity region 37 47 N/A INTRINSIC
Pfam:Glyco_transf_29 102 373 5.7e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097912
AA Change: M197I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000095525
Gene: ENSMUSG00000028538
AA Change: M197I

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Glyco_transf_29 86 357 5.4e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106410
AA Change: M213I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000102018
Gene: ENSMUSG00000028538
AA Change: M213I

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
low complexity region 37 47 N/A INTRINSIC
Pfam:Glyco_transf_29 106 372 4.7e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126336
AA Change: M107I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000121051
Gene: ENSMUSG00000028538
AA Change: M107I

DomainStartEndE-ValueType
Pfam:Glyco_transf_29 1 159 4.9e-44 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000114444
Gene: ENSMUSG00000028538
AA Change: M158I

DomainStartEndE-ValueType
Pfam:Glyco_transf_29 52 264 4.8e-38 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type II membrane protein that catalyzes the transfer of sialic acid from CMP-sialic acid to galactose-containing substrates. The encoded protein is normally found in the Golgi apparatus but can be proteolytically processed to a soluble form. This protein is a member of glycosyltransferase family 29. Mutations in this gene have been associated with autosomal recessive nonsymdromic mental retardation-12 (MRT12). Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene show an apparently normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T C 19: 9,015,235 S4628P probably damaging Het
Aspm G A 1: 139,463,182 R735H possibly damaging Het
Atp4a T C 7: 30,715,008 V152A probably benign Het
BC035947 G A 1: 78,498,488 T469I probably damaging Het
Bicra A T 7: 15,988,762 S277T probably benign Het
Catsperg1 A T 7: 29,181,702 N1142K possibly damaging Het
Ccnd3 T C 17: 47,578,720 probably benign Het
Cdc25a A G 9: 109,879,927 K79E probably damaging Het
Cfap44 A G 16: 44,449,028 probably null Het
Chd5 C A 4: 152,382,938 N1644K probably damaging Het
Flrt3 C T 2: 140,660,718 R330H probably damaging Het
Gm6034 T A 17: 36,057,218 probably null Het
Hivep1 A G 13: 42,156,507 E741G probably damaging Het
Iqgap3 T C 3: 88,096,951 V448A probably damaging Het
Itsn2 A G 12: 4,652,382 R679G probably benign Het
Klrb1c A G 6: 128,788,418 S70P possibly damaging Het
Maml2 C T 9: 13,705,835 T159I possibly damaging Het
Mroh2a G A 1: 88,243,950 R770Q probably damaging Het
Mycl G A 4: 123,000,246 D280N probably damaging Het
Nlrp1b G A 11: 71,228,433 T12I possibly damaging Het
Olfr1315-ps1 T C 2: 112,110,647 N202D probably benign Het
Olfr187 A C 16: 59,036,065 I224S possibly damaging Het
Palmd A G 3: 116,923,463 S462P probably benign Het
Phyhd1 A C 2: 30,269,761 I36L possibly damaging Het
Plcd1 T C 9: 119,074,321 probably null Het
Pml G C 9: 58,219,906 A806G probably damaging Het
Ppp6r1 C A 7: 4,632,396 A838S probably benign Het
Pqlc3 G A 12: 16,999,829 L43F probably damaging Het
Prkdc C T 16: 15,651,538 T169I probably damaging Het
Prr23a1 G T 9: 98,842,935 V117L possibly damaging Het
Pus7 T C 5: 23,768,847 silent Het
Rdh7 T C 10: 127,888,381 E78G probably benign Het
Repin1 G T 6: 48,593,891 probably benign Het
Rptn A G 3: 93,398,123 N921S possibly damaging Het
Sema4f A G 6: 82,918,002 L404P probably damaging Het
Serinc4 T A 2: 121,456,550 M2L probably benign Het
Siglecf T C 7: 43,352,180 V138A probably benign Het
Speer2 T A 16: 69,858,887 Q106L probably damaging Het
Sptb G A 12: 76,603,480 P1821L probably damaging Het
Tmem25 T C 9: 44,796,008 K265E possibly damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Vsig10 G A 5: 117,338,407 V309I probably benign Het
Zfp318 G GAAGAAA 17: 46,412,542 probably benign Het
Other mutations in St3gal3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01933:St3gal3 APN 4 118031875 missense probably damaging 1.00
IGL02004:St3gal3 APN 4 117960039 missense possibly damaging 0.90
IGL02339:St3gal3 APN 4 117958562 missense probably damaging 1.00
IGL03186:St3gal3 APN 4 117940054 missense possibly damaging 0.93
giovanni UTSW 4 117960007 missense possibly damaging 0.84
Leporello UTSW 4 117957436 missense
R0598:St3gal3 UTSW 4 118107632 missense probably benign 0.38
R1466:St3gal3 UTSW 4 118107662 start codon destroyed probably null
R1466:St3gal3 UTSW 4 118107662 start codon destroyed probably null
R1474:St3gal3 UTSW 4 118014786 missense probably damaging 1.00
R1584:St3gal3 UTSW 4 118107662 start codon destroyed probably null
R1585:St3gal3 UTSW 4 117960007 missense possibly damaging 0.84
R1696:St3gal3 UTSW 4 117940392 missense possibly damaging 0.52
R1735:St3gal3 UTSW 4 118014774 missense probably damaging 1.00
R1958:St3gal3 UTSW 4 117940071 missense probably damaging 0.96
R4008:St3gal3 UTSW 4 117940440 missense probably benign 0.34
R4700:St3gal3 UTSW 4 117960035 missense probably benign 0.01
R5434:St3gal3 UTSW 4 117940050 missense probably damaging 1.00
R6257:St3gal3 UTSW 4 118107678 start gained probably benign
R7218:St3gal3 UTSW 4 117957442 missense
R7304:St3gal3 UTSW 4 117957436 missense
R7569:St3gal3 UTSW 4 117964356 missense probably benign 0.09
R7783:St3gal3 UTSW 4 117940123 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- GTCACCCTGATATTGTCTGGC -3'
(R):5'- GGTCGGCAGGTTTTAAAACAAAC -3'

Sequencing Primer
(F):5'- TGTGGGATCTGATGCAGAGACTAC -3'
(R):5'- CAAGGAGGTGGCCTGGATTC -3'
Posted On2018-09-12