Incidental Mutation 'R6854:Mycl'
ID535139
Institutional Source Beutler Lab
Gene Symbol Mycl
Ensembl Gene ENSMUSG00000028654
Gene Namev-myc avian myelocytomatosis viral oncogene lung carcinoma derived
SynonymsLmyc-1, Lmyc1, bHLHe38, L-myc, Mycl1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6854 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location122995652-123002485 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 123000246 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 280 (D280N)
Ref Sequence ENSEMBL: ENSMUSP00000101859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030407] [ENSMUST00000106252] [ENSMUST00000144998]
Predicted Effect probably damaging
Transcript: ENSMUST00000030407
AA Change: D280N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030407
Gene: ENSMUSG00000028654
AA Change: D280N

DomainStartEndE-ValueType
Pfam:Myc_N 1 161 6.7e-29 PFAM
Pfam:Myc_N 137 230 1.1e-11 PFAM
HLH 291 343 6.07e-14 SMART
low complexity region 348 361 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106252
AA Change: D280N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101859
Gene: ENSMUSG00000028654
AA Change: D280N

DomainStartEndE-ValueType
Pfam:Myc_N 1 157 3.4e-31 PFAM
Pfam:Myc_N 116 231 1e-9 PFAM
HLH 291 343 6.07e-14 SMART
low complexity region 348 361 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144998
SMART Domains Protein: ENSMUSP00000117232
Gene: ENSMUSG00000028654

DomainStartEndE-ValueType
Pfam:Myc_N 1 58 7.8e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: This gene encodes a basic helix-loop-helix leucine zipper (bHLHZip) protein that heterodimerizes with another bHLHZip protein to drive transcription of targets important for proliferation, apoptosis and differentiation. Mice lacking this gene product show marked decrease in T-cell priming during bacterial and viral infections. In humans, this gene was found to be amplified in small-cell lung cancers. Alternate splicing of this gene results in multiple variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a targeted null allele are viable, fertile and apparently healthy with no congenital defects or gross morphological/cellular alterations of the CNS, lung, kidney and GI tract. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T C 19: 9,015,235 S4628P probably damaging Het
Aspm G A 1: 139,463,182 R735H possibly damaging Het
Atp4a T C 7: 30,715,008 V152A probably benign Het
BC035947 G A 1: 78,498,488 T469I probably damaging Het
Bicra A T 7: 15,988,762 S277T probably benign Het
Catsperg1 A T 7: 29,181,702 N1142K possibly damaging Het
Ccnd3 T C 17: 47,578,720 probably benign Het
Cdc25a A G 9: 109,879,927 K79E probably damaging Het
Cfap44 A G 16: 44,449,028 probably null Het
Chd5 C A 4: 152,382,938 N1644K probably damaging Het
Flrt3 C T 2: 140,660,718 R330H probably damaging Het
Gm6034 T A 17: 36,057,218 probably null Het
Hivep1 A G 13: 42,156,507 E741G probably damaging Het
Iqgap3 T C 3: 88,096,951 V448A probably damaging Het
Itsn2 A G 12: 4,652,382 R679G probably benign Het
Klrb1c A G 6: 128,788,418 S70P possibly damaging Het
Maml2 C T 9: 13,705,835 T159I possibly damaging Het
Mroh2a G A 1: 88,243,950 R770Q probably damaging Het
Nlrp1b G A 11: 71,228,433 T12I possibly damaging Het
Olfr1315-ps1 T C 2: 112,110,647 N202D probably benign Het
Olfr187 A C 16: 59,036,065 I224S possibly damaging Het
Palmd A G 3: 116,923,463 S462P probably benign Het
Phyhd1 A C 2: 30,269,761 I36L possibly damaging Het
Plcd1 T C 9: 119,074,321 probably null Het
Pml G C 9: 58,219,906 A806G probably damaging Het
Ppp6r1 C A 7: 4,632,396 A838S probably benign Het
Pqlc3 G A 12: 16,999,829 L43F probably damaging Het
Prkdc C T 16: 15,651,538 T169I probably damaging Het
Prr23a1 G T 9: 98,842,935 V117L possibly damaging Het
Pus7 T C 5: 23,768,847 silent Het
Rdh7 T C 10: 127,888,381 E78G probably benign Het
Repin1 G T 6: 48,593,891 probably benign Het
Rptn A G 3: 93,398,123 N921S possibly damaging Het
Sema4f A G 6: 82,918,002 L404P probably damaging Het
Serinc4 T A 2: 121,456,550 M2L probably benign Het
Siglecf T C 7: 43,352,180 V138A probably benign Het
Speer2 T A 16: 69,858,887 Q106L probably damaging Het
Sptb G A 12: 76,603,480 P1821L probably damaging Het
St3gal3 C A 4: 117,958,530 M107I probably benign Het
Tmem25 T C 9: 44,796,008 K265E possibly damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Vsig10 G A 5: 117,338,407 V309I probably benign Het
Zfp318 G GAAGAAA 17: 46,412,542 probably benign Het
Other mutations in Mycl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02529:Mycl APN 4 122996977 missense probably damaging 1.00
IGL02678:Mycl APN 4 122999983 missense probably damaging 1.00
R1509:Mycl UTSW 4 123000307 missense probably damaging 1.00
R2348:Mycl UTSW 4 122996952 missense probably benign 0.07
R4050:Mycl UTSW 4 122996839 unclassified probably null
R4209:Mycl UTSW 4 122999922 missense possibly damaging 0.57
R4798:Mycl UTSW 4 123000256 missense probably damaging 1.00
R5267:Mycl UTSW 4 123000496 missense probably damaging 1.00
R5795:Mycl UTSW 4 122996622 missense probably damaging 1.00
R6195:Mycl UTSW 4 122999920 missense probably damaging 1.00
R6233:Mycl UTSW 4 122999920 missense probably damaging 1.00
R7050:Mycl UTSW 4 122997020 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCCCGTTTTCCTCCAGAAAG -3'
(R):5'- CGGAGCTGCCTTTTCTCTGTAG -3'

Sequencing Primer
(F):5'- TTCCTCCAGAAAGTTGCTCTCAAGAG -3'
(R):5'- TCTTTTCAGCCCCCACCAAAG -3'
Posted On2018-09-12