Incidental Mutation 'R6854:Repin1'
ID535142
Institutional Source Beutler Lab
Gene Symbol Repin1
Ensembl Gene ENSMUSG00000052751
Gene Namereplication initiator 1
SynonymsZfp464, E430037F08Rik, AP4
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6854 (G1)
Quality Score123.008
Status Validated
Chromosome6
Chromosomal Location48593883-48599082 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to T at 48593891 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009420] [ENSMUST00000064744] [ENSMUST00000118229] [ENSMUST00000135151] [ENSMUST00000154010] [ENSMUST00000163452] [ENSMUST00000204121] [ENSMUST00000204521]
Predicted Effect probably benign
Transcript: ENSMUST00000009420
SMART Domains Protein: ENSMUSP00000009420
Gene: ENSMUSG00000052751

DomainStartEndE-ValueType
ZnF_C2H2 52 72 3.47e1 SMART
ZnF_C2H2 80 102 5.81e-2 SMART
ZnF_C2H2 111 133 5.5e-3 SMART
ZnF_C2H2 140 160 1.16e1 SMART
ZnF_C2H2 172 194 3.89e-3 SMART
low complexity region 196 224 N/A INTRINSIC
ZnF_C2H2 229 251 1.67e-2 SMART
ZnF_C2H2 257 279 4.94e-5 SMART
ZnF_C2H2 285 307 5.21e-4 SMART
ZnF_C2H2 353 375 4.72e-2 SMART
ZnF_C2H2 381 403 1.26e-2 SMART
ZnF_C2H2 409 431 1.79e-2 SMART
ZnF_C2H2 437 459 4.24e-4 SMART
ZnF_C2H2 465 487 6.52e-5 SMART
ZnF_C2H2 493 515 2.61e-4 SMART
ZnF_C2H2 521 543 1.45e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000064744
SMART Domains Protein: ENSMUSP00000064804
Gene: ENSMUSG00000052730

DomainStartEndE-ValueType
low complexity region 160 174 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118229
SMART Domains Protein: ENSMUSP00000113548
Gene: ENSMUSG00000052751

DomainStartEndE-ValueType
ZnF_C2H2 52 72 3.47e1 SMART
ZnF_C2H2 80 102 5.81e-2 SMART
ZnF_C2H2 111 133 5.5e-3 SMART
ZnF_C2H2 140 160 1.16e1 SMART
ZnF_C2H2 172 194 3.89e-3 SMART
low complexity region 196 224 N/A INTRINSIC
ZnF_C2H2 229 251 1.67e-2 SMART
ZnF_C2H2 257 279 4.94e-5 SMART
ZnF_C2H2 285 307 5.21e-4 SMART
ZnF_C2H2 353 375 4.72e-2 SMART
ZnF_C2H2 381 403 1.26e-2 SMART
ZnF_C2H2 409 431 1.79e-2 SMART
ZnF_C2H2 437 459 4.24e-4 SMART
ZnF_C2H2 465 487 6.52e-5 SMART
ZnF_C2H2 493 515 2.61e-4 SMART
ZnF_C2H2 521 543 1.45e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135151
SMART Domains Protein: ENSMUSP00000118890
Gene: ENSMUSG00000052751

DomainStartEndE-ValueType
ZnF_C2H2 52 72 3.47e1 SMART
ZnF_C2H2 80 102 5.81e-2 SMART
ZnF_C2H2 111 133 5.5e-3 SMART
ZnF_C2H2 140 160 1.16e1 SMART
ZnF_C2H2 172 194 3.89e-3 SMART
low complexity region 196 224 N/A INTRINSIC
ZnF_C2H2 229 251 1.67e-2 SMART
ZnF_C2H2 257 279 4.94e-5 SMART
Pfam:zf-C2H2_6 284 300 1.4e-1 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154010
SMART Domains Protein: ENSMUSP00000121975
Gene: ENSMUSG00000052751

DomainStartEndE-ValueType
ZnF_C2H2 52 72 3.47e1 SMART
ZnF_C2H2 80 102 5.81e-2 SMART
ZnF_C2H2 111 133 5.5e-3 SMART
ZnF_C2H2 140 160 1.16e1 SMART
ZnF_C2H2 172 194 3.89e-3 SMART
low complexity region 196 224 N/A INTRINSIC
ZnF_C2H2 229 251 1.67e-2 SMART
ZnF_C2H2 257 279 4.94e-5 SMART
ZnF_C2H2 285 307 5.21e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163452
SMART Domains Protein: ENSMUSP00000132365
Gene: ENSMUSG00000052751

DomainStartEndE-ValueType
ZnF_C2H2 52 72 3.47e1 SMART
ZnF_C2H2 80 102 5.81e-2 SMART
ZnF_C2H2 111 133 5.5e-3 SMART
ZnF_C2H2 140 160 1.16e1 SMART
ZnF_C2H2 172 194 3.89e-3 SMART
low complexity region 196 224 N/A INTRINSIC
ZnF_C2H2 229 251 1.67e-2 SMART
ZnF_C2H2 257 279 4.94e-5 SMART
ZnF_C2H2 285 307 5.21e-4 SMART
ZnF_C2H2 353 375 4.72e-2 SMART
ZnF_C2H2 381 403 1.26e-2 SMART
ZnF_C2H2 409 431 1.79e-2 SMART
ZnF_C2H2 437 459 4.24e-4 SMART
ZnF_C2H2 465 487 6.52e-5 SMART
ZnF_C2H2 493 515 2.61e-4 SMART
ZnF_C2H2 521 543 1.45e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204121
Predicted Effect probably benign
Transcript: ENSMUST00000204521
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (44/44)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele improves in insulin sensitivity and glucose metabolism in Leprdb homozygotes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T C 19: 9,015,235 S4628P probably damaging Het
Aspm G A 1: 139,463,182 R735H possibly damaging Het
Atp4a T C 7: 30,715,008 V152A probably benign Het
BC035947 G A 1: 78,498,488 T469I probably damaging Het
Bicra A T 7: 15,988,762 S277T probably benign Het
Catsperg1 A T 7: 29,181,702 N1142K possibly damaging Het
Ccnd3 T C 17: 47,578,720 probably benign Het
Cdc25a A G 9: 109,879,927 K79E probably damaging Het
Cfap44 A G 16: 44,449,028 probably null Het
Chd5 C A 4: 152,382,938 N1644K probably damaging Het
Flrt3 C T 2: 140,660,718 R330H probably damaging Het
Gm6034 T A 17: 36,057,218 probably null Het
Hivep1 A G 13: 42,156,507 E741G probably damaging Het
Iqgap3 T C 3: 88,096,951 V448A probably damaging Het
Itsn2 A G 12: 4,652,382 R679G probably benign Het
Klrb1c A G 6: 128,788,418 S70P possibly damaging Het
Maml2 C T 9: 13,705,835 T159I possibly damaging Het
Mroh2a G A 1: 88,243,950 R770Q probably damaging Het
Mycl G A 4: 123,000,246 D280N probably damaging Het
Nlrp1b G A 11: 71,228,433 T12I possibly damaging Het
Olfr1315-ps1 T C 2: 112,110,647 N202D probably benign Het
Olfr187 A C 16: 59,036,065 I224S possibly damaging Het
Palmd A G 3: 116,923,463 S462P probably benign Het
Phyhd1 A C 2: 30,269,761 I36L possibly damaging Het
Plcd1 T C 9: 119,074,321 probably null Het
Pml G C 9: 58,219,906 A806G probably damaging Het
Ppp6r1 C A 7: 4,632,396 A838S probably benign Het
Pqlc3 G A 12: 16,999,829 L43F probably damaging Het
Prkdc C T 16: 15,651,538 T169I probably damaging Het
Prr23a1 G T 9: 98,842,935 V117L possibly damaging Het
Pus7 T C 5: 23,768,847 silent Het
Rdh7 T C 10: 127,888,381 E78G probably benign Het
Rptn A G 3: 93,398,123 N921S possibly damaging Het
Sema4f A G 6: 82,918,002 L404P probably damaging Het
Serinc4 T A 2: 121,456,550 M2L probably benign Het
Siglecf T C 7: 43,352,180 V138A probably benign Het
Speer2 T A 16: 69,858,887 Q106L probably damaging Het
Sptb G A 12: 76,603,480 P1821L probably damaging Het
St3gal3 C A 4: 117,958,530 M107I probably benign Het
Tmem25 T C 9: 44,796,008 K265E possibly damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Vsig10 G A 5: 117,338,407 V309I probably benign Het
Zfp318 G GAAGAAA 17: 46,412,542 probably benign Het
Other mutations in Repin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01100:Repin1 APN 6 48596905 missense probably damaging 1.00
IGL01103:Repin1 APN 6 48597953 intron probably benign
IGL02027:Repin1 APN 6 48596473 missense probably damaging 1.00
IGL02143:Repin1 APN 6 48597121 missense probably damaging 1.00
R0395:Repin1 UTSW 6 48597525 missense probably damaging 1.00
R1233:Repin1 UTSW 6 48597834 missense possibly damaging 0.72
R1743:Repin1 UTSW 6 48597750 missense probably damaging 0.96
R2259:Repin1 UTSW 6 48596530 missense probably benign 0.00
R4509:Repin1 UTSW 6 48596526 missense possibly damaging 0.77
R5008:Repin1 UTSW 6 48596608 missense probably damaging 1.00
R5009:Repin1 UTSW 6 48594845 intron probably benign
R5425:Repin1 UTSW 6 48596431 missense probably benign 0.18
R5829:Repin1 UTSW 6 48594832 intron probably benign
R6350:Repin1 UTSW 6 48597628 missense probably damaging 0.98
R6841:Repin1 UTSW 6 48597925 missense possibly damaging 0.95
R7067:Repin1 UTSW 6 48597916 nonsense probably null
R7636:Repin1 UTSW 6 48596365 missense probably benign 0.00
R7699:Repin1 UTSW 6 48597822 missense probably damaging 0.96
R7700:Repin1 UTSW 6 48597822 missense probably damaging 0.96
R7747:Repin1 UTSW 6 48597345 nonsense probably null
R7748:Repin1 UTSW 6 48597345 nonsense probably null
R7781:Repin1 UTSW 6 48597345 nonsense probably null
R7815:Repin1 UTSW 6 48597345 nonsense probably null
R7820:Repin1 UTSW 6 48597345 nonsense probably null
R7869:Repin1 UTSW 6 48597345 nonsense probably null
R7952:Repin1 UTSW 6 48597345 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAGGAAACTGAAGCTCGGGC -3'
(R):5'- ATAGATGCGTGTCCTCCGTC -3'

Sequencing Primer
(F):5'- TGAAGCTCGGGCCGGTG -3'
(R):5'- GTTCGAGTTCACAACTGC -3'
Posted On2018-09-12