Incidental Mutation 'R6854:Klrb1c'
ID535145
Institutional Source Beutler Lab
Gene Symbol Klrb1c
Ensembl Gene ENSMUSG00000030325
Gene Namekiller cell lectin-like receptor subfamily B member 1C
SynonymsNK-RP1, Nk1.1, Nk1, Ly-59, Ly59, Ly55c, CD161, Nkrp1-c, Nk-1, NKR-P1C, NK-1.1, Nk-1.2, NKR-P1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R6854 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location128778485-128789215 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128788418 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 70 (S70P)
Ref Sequence ENSEMBL: ENSMUSP00000134504 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167691] [ENSMUST00000174404] [ENSMUST00000174865] [ENSMUST00000204394] [ENSMUST00000204423] [ENSMUST00000204677] [ENSMUST00000204756]
Predicted Effect possibly damaging
Transcript: ENSMUST00000167691
AA Change: S70P

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127297
Gene: ENSMUSG00000030325
AA Change: S70P

DomainStartEndE-ValueType
transmembrane domain 87 109 N/A INTRINSIC
CLECT 139 256 1.65e-25 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000134184
Gene: ENSMUSG00000030325
AA Change: S23P

DomainStartEndE-ValueType
transmembrane domain 41 63 N/A INTRINSIC
CLECT 90 207 1.65e-25 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000174404
AA Change: S70P

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134504
Gene: ENSMUSG00000030325
AA Change: S70P

DomainStartEndE-ValueType
transmembrane domain 87 109 N/A INTRINSIC
CLECT 142 259 1.65e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174865
AA Change: S54P

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000134055
Gene: ENSMUSG00000030325
AA Change: S54P

DomainStartEndE-ValueType
transmembrane domain 76 98 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204394
SMART Domains Protein: ENSMUSP00000145481
Gene: ENSMUSG00000107872

DomainStartEndE-ValueType
transmembrane domain 44 66 N/A INTRINSIC
CLECT 94 211 8.5e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204423
SMART Domains Protein: ENSMUSP00000145327
Gene: ENSMUSG00000107872

DomainStartEndE-ValueType
transmembrane domain 44 66 N/A INTRINSIC
CLECT 94 211 8.7e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204677
SMART Domains Protein: ENSMUSP00000145287
Gene: ENSMUSG00000107872

DomainStartEndE-ValueType
transmembrane domain 44 66 N/A INTRINSIC
PDB:3M9Z|A 89 144 2e-30 PDB
SCOP:d1e87a_ 94 143 2e-12 SMART
Blast:CLECT 94 144 3e-30 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000204756
SMART Domains Protein: ENSMUSP00000144777
Gene: ENSMUSG00000107872

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
CLECT 85 185 1e-14 SMART
Meta Mutation Damage Score 0.0980 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (44/44)
MGI Phenotype PHENOTYPE: This locus controls an antigen on natural killer cells. The a allele determines the Nk1.1 antigen in strains CE, C57BL/6, C57BR/cd, C57L, C58, DBA/1, MA/My, NZB, SJL, SM and B10.D2. The b allele determines the Nk1.2 antigen in strains CBA/J, BALB/c, C3H/He, A/J, DBA/2, LP and 129. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T C 19: 9,015,235 S4628P probably damaging Het
Aspm G A 1: 139,463,182 R735H possibly damaging Het
Atp4a T C 7: 30,715,008 V152A probably benign Het
BC035947 G A 1: 78,498,488 T469I probably damaging Het
Bicra A T 7: 15,988,762 S277T probably benign Het
Catsperg1 A T 7: 29,181,702 N1142K possibly damaging Het
Ccnd3 T C 17: 47,578,720 probably benign Het
Cdc25a A G 9: 109,879,927 K79E probably damaging Het
Cfap44 A G 16: 44,449,028 probably null Het
Chd5 C A 4: 152,382,938 N1644K probably damaging Het
Flrt3 C T 2: 140,660,718 R330H probably damaging Het
Gm6034 T A 17: 36,057,218 probably null Het
Hivep1 A G 13: 42,156,507 E741G probably damaging Het
Iqgap3 T C 3: 88,096,951 V448A probably damaging Het
Itsn2 A G 12: 4,652,382 R679G probably benign Het
Maml2 C T 9: 13,705,835 T159I possibly damaging Het
Mroh2a G A 1: 88,243,950 R770Q probably damaging Het
Mycl G A 4: 123,000,246 D280N probably damaging Het
Nlrp1b G A 11: 71,228,433 T12I possibly damaging Het
Olfr1315-ps1 T C 2: 112,110,647 N202D probably benign Het
Olfr187 A C 16: 59,036,065 I224S possibly damaging Het
Palmd A G 3: 116,923,463 S462P probably benign Het
Phyhd1 A C 2: 30,269,761 I36L possibly damaging Het
Plcd1 T C 9: 119,074,321 probably null Het
Pml G C 9: 58,219,906 A806G probably damaging Het
Ppp6r1 C A 7: 4,632,396 A838S probably benign Het
Pqlc3 G A 12: 16,999,829 L43F probably damaging Het
Prkdc C T 16: 15,651,538 T169I probably damaging Het
Prr23a1 G T 9: 98,842,935 V117L possibly damaging Het
Pus7 T C 5: 23,768,847 silent Het
Rdh7 T C 10: 127,888,381 E78G probably benign Het
Repin1 G T 6: 48,593,891 probably benign Het
Rptn A G 3: 93,398,123 N921S possibly damaging Het
Sema4f A G 6: 82,918,002 L404P probably damaging Het
Serinc4 T A 2: 121,456,550 M2L probably benign Het
Siglecf T C 7: 43,352,180 V138A probably benign Het
Speer2 T A 16: 69,858,887 Q106L probably damaging Het
Sptb G A 12: 76,603,480 P1821L probably damaging Het
St3gal3 C A 4: 117,958,530 M107I probably benign Het
Tmem25 T C 9: 44,796,008 K265E possibly damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Vsig10 G A 5: 117,338,407 V309I probably benign Het
Zfp318 G GAAGAAA 17: 46,412,542 probably benign Het
Other mutations in Klrb1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02636:Klrb1c APN 6 128788552 missense probably benign 0.01
Freakish UTSW 6 128784185 missense probably benign 0.38
Unnatural UTSW 6 128784211 missense probably benign 0.09
wacky UTSW 6 128780343 missense probably damaging 1.00
Weird UTSW 6 128784257 missense probably benign 0.00
Wild UTSW 6 128786005 missense probably benign 0.09
R0463:Klrb1c UTSW 6 128780403 missense probably benign 0.07
R3157:Klrb1c UTSW 6 128784739 missense possibly damaging 0.88
R3779:Klrb1c UTSW 6 128780343 missense probably damaging 1.00
R5111:Klrb1c UTSW 6 128786005 missense probably benign 0.09
R5149:Klrb1c UTSW 6 128783707 missense probably benign 0.07
R5196:Klrb1c UTSW 6 128780299 missense probably benign 0.00
R5568:Klrb1c UTSW 6 128788914 intron probably benign
R5620:Klrb1c UTSW 6 128784743 missense possibly damaging 0.67
R6000:Klrb1c UTSW 6 128784157 missense probably damaging 1.00
R6483:Klrb1c UTSW 6 128784185 missense probably benign 0.38
R7283:Klrb1c UTSW 6 128784257 missense probably benign 0.00
R7697:Klrb1c UTSW 6 128780310 missense probably benign 0.02
Z1177:Klrb1c UTSW 6 128788447 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAGTTTCACACTGACTGACTG -3'
(R):5'- CCCTCAGAGACAGGAATCAGTG -3'

Sequencing Primer
(F):5'- CACACTGACTGACTGATTAAAGATGG -3'
(R):5'- TCAGTGGGTGTGGGAACAG -3'
Posted On2018-09-12