Incidental Mutation 'R6854:Siglecf'
ID535150
Institutional Source Beutler Lab
Gene Symbol Siglecf
Ensembl Gene ENSMUSG00000039013
Gene Namesialic acid binding Ig-like lectin F
SynonymsmSiglec-F, Siglec5
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6854 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location43351341-43359531 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43352180 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 138 (V138A)
Ref Sequence ENSEMBL: ENSMUSP00000113245 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012798] [ENSMUST00000121494] [ENSMUST00000122423] [ENSMUST00000206299]
Predicted Effect probably benign
Transcript: ENSMUST00000012798
AA Change: V138A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000012798
Gene: ENSMUSG00000039013
AA Change: V138A

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 25 131 6.07e-3 SMART
IG_like 142 226 4.91e1 SMART
IGc2 256 315 8.7e-13 SMART
transmembrane domain 440 462 N/A INTRINSIC
low complexity region 486 500 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121494
AA Change: V138A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000112583
Gene: ENSMUSG00000039013
AA Change: V138A

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 25 131 6.07e-3 SMART
IG_like 142 226 4.91e1 SMART
IGc2 256 315 8.7e-13 SMART
Pfam:Ig_2 329 421 2.4e-3 PFAM
transmembrane domain 440 462 N/A INTRINSIC
low complexity region 486 500 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122423
AA Change: V138A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000113245
Gene: ENSMUSG00000039013
AA Change: V138A

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 25 131 6.07e-3 SMART
IG_like 142 226 4.91e1 SMART
IGc2 256 315 8.7e-13 SMART
Pfam:Ig_2 329 421 5.1e-4 PFAM
transmembrane domain 440 462 N/A INTRINSIC
low complexity region 486 500 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206299
AA Change: V138A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sialic acid-binding immunoglobulin (Ig)-like lectins, or SIGLECs (e.g., CD33 (MIM 159590)), are a family of type 1 transmembrane proteins each having a unique expression pattern, mostly in hemopoietic cells. SIGLEC8 is a member of the CD33-like subgroup of SIGLECs, which are localized to 19q13.3-q13.4 and have 2 conserved cytoplasmic tyrosine-based motifs: an immunoreceptor tyrosine-based inhibitory motif, or ITIM (see MIM 604964), and a motif homologous to one identified in signaling lymphocyte activation molecule (SLAM; MIM 603492) that mediates an association with SLAM-associated protein (SAP; MIM 300490) (summarized by Foussias et al., 2000 [PubMed 11095983]).[supplied by OMIM, May 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased lung inflammation in response to ovalbumin challenge with increased eosinophils, delayed eosinophil resolution and impaired eosinophil apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T C 19: 9,015,235 S4628P probably damaging Het
Aspm G A 1: 139,463,182 R735H possibly damaging Het
Atp4a T C 7: 30,715,008 V152A probably benign Het
BC035947 G A 1: 78,498,488 T469I probably damaging Het
Bicra A T 7: 15,988,762 S277T probably benign Het
Catsperg1 A T 7: 29,181,702 N1142K possibly damaging Het
Ccnd3 T C 17: 47,578,720 probably benign Het
Cdc25a A G 9: 109,879,927 K79E probably damaging Het
Cfap44 A G 16: 44,449,028 probably null Het
Chd5 C A 4: 152,382,938 N1644K probably damaging Het
Flrt3 C T 2: 140,660,718 R330H probably damaging Het
Gm6034 T A 17: 36,057,218 probably null Het
Hivep1 A G 13: 42,156,507 E741G probably damaging Het
Iqgap3 T C 3: 88,096,951 V448A probably damaging Het
Itsn2 A G 12: 4,652,382 R679G probably benign Het
Klrb1c A G 6: 128,788,418 S70P possibly damaging Het
Maml2 C T 9: 13,705,835 T159I possibly damaging Het
Mroh2a G A 1: 88,243,950 R770Q probably damaging Het
Mycl G A 4: 123,000,246 D280N probably damaging Het
Nlrp1b G A 11: 71,228,433 T12I possibly damaging Het
Olfr1315-ps1 T C 2: 112,110,647 N202D probably benign Het
Olfr187 A C 16: 59,036,065 I224S possibly damaging Het
Palmd A G 3: 116,923,463 S462P probably benign Het
Phyhd1 A C 2: 30,269,761 I36L possibly damaging Het
Plcd1 T C 9: 119,074,321 probably null Het
Pml G C 9: 58,219,906 A806G probably damaging Het
Ppp6r1 C A 7: 4,632,396 A838S probably benign Het
Pqlc3 G A 12: 16,999,829 L43F probably damaging Het
Prkdc C T 16: 15,651,538 T169I probably damaging Het
Prr23a1 G T 9: 98,842,935 V117L possibly damaging Het
Pus7 T C 5: 23,768,847 silent Het
Rdh7 T C 10: 127,888,381 E78G probably benign Het
Repin1 G T 6: 48,593,891 probably benign Het
Rptn A G 3: 93,398,123 N921S possibly damaging Het
Sema4f A G 6: 82,918,002 L404P probably damaging Het
Serinc4 T A 2: 121,456,550 M2L probably benign Het
Speer2 T A 16: 69,858,887 Q106L probably damaging Het
Sptb G A 12: 76,603,480 P1821L probably damaging Het
St3gal3 C A 4: 117,958,530 M107I probably benign Het
Tmem25 T C 9: 44,796,008 K265E possibly damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Vsig10 G A 5: 117,338,407 V309I probably benign Het
Zfp318 G GAAGAAA 17: 46,412,542 probably benign Het
Other mutations in Siglecf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Siglecf APN 7 43351953 nonsense probably null
IGL01350:Siglecf APN 7 43355895 intron probably benign
IGL01458:Siglecf APN 7 43355138 missense possibly damaging 0.46
IGL01582:Siglecf APN 7 43358721 missense possibly damaging 0.55
IGL02347:Siglecf APN 7 43351721 missense possibly damaging 0.78
IGL02530:Siglecf APN 7 43352210 missense probably benign 0.07
IGL02700:Siglecf APN 7 43352378 missense probably damaging 1.00
IGL03093:Siglecf APN 7 43352441 missense probably damaging 1.00
IGL03178:Siglecf APN 7 43358739 missense probably damaging 0.98
IGL03280:Siglecf APN 7 43355930 missense probably benign 0.04
ANU23:Siglecf UTSW 7 43351953 nonsense probably null
R0003:Siglecf UTSW 7 43355926 missense probably benign
R0025:Siglecf UTSW 7 43351925 missense probably benign 0.29
R0304:Siglecf UTSW 7 43352401 missense probably damaging 1.00
R0345:Siglecf UTSW 7 43351944 missense probably damaging 1.00
R0395:Siglecf UTSW 7 43355975 missense probably damaging 1.00
R0515:Siglecf UTSW 7 43355631 critical splice donor site probably null
R1296:Siglecf UTSW 7 43355920 nonsense probably null
R1861:Siglecf UTSW 7 43352224 missense probably benign 0.00
R1861:Siglecf UTSW 7 43355543 missense probably benign 0.01
R1869:Siglecf UTSW 7 43355543 missense probably benign 0.01
R1870:Siglecf UTSW 7 43355543 missense probably benign 0.01
R1871:Siglecf UTSW 7 43355543 missense probably benign 0.01
R2063:Siglecf UTSW 7 43352380 missense possibly damaging 0.79
R2176:Siglecf UTSW 7 43351716 missense probably damaging 0.98
R2237:Siglecf UTSW 7 43354985 missense probably benign 0.06
R4023:Siglecf UTSW 7 43355571 missense possibly damaging 0.56
R4498:Siglecf UTSW 7 43352276 missense possibly damaging 0.47
R4664:Siglecf UTSW 7 43356413 missense possibly damaging 0.75
R5227:Siglecf UTSW 7 43351940 missense probably damaging 1.00
R5315:Siglecf UTSW 7 43355108 missense probably benign 0.01
R5763:Siglecf UTSW 7 43356320 nonsense probably null
R5828:Siglecf UTSW 7 43351713 missense probably damaging 1.00
R5871:Siglecf UTSW 7 43355621 missense probably benign 0.04
R5952:Siglecf UTSW 7 43355927 missense probably benign 0.00
R6054:Siglecf UTSW 7 43355006 missense probably damaging 1.00
R6537:Siglecf UTSW 7 43355999 missense probably benign
R6875:Siglecf UTSW 7 43355200 missense probably benign 0.04
R7328:Siglecf UTSW 7 43352267 missense possibly damaging 0.92
R7329:Siglecf UTSW 7 43351971 missense probably damaging 1.00
R7356:Siglecf UTSW 7 43356431 missense probably benign 0.00
R7369:Siglecf UTSW 7 43351817 missense probably damaging 0.99
R7659:Siglecf UTSW 7 43351770 missense probably damaging 1.00
R8074:Siglecf UTSW 7 43351790 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TCGACACAGGGACGTACTTC -3'
(R):5'- TGAGGTTCAGCTCTGAGGAG -3'

Sequencing Primer
(F):5'- CACAGGGACGTACTTCTTCAGATTG -3'
(R):5'- TCAGCTCTGAGGAGAGGGTG -3'
Posted On2018-09-12