Incidental Mutation 'R6854:Maml2'
ID535151
Institutional Source Beutler Lab
Gene Symbol Maml2
Ensembl Gene ENSMUSG00000031925
Gene Namemastermind like transcriptional coactivator 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6854 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location13297957-13709388 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 13705835 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 159 (T159I)
Ref Sequence ENSEMBL: ENSMUSP00000136866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034401] [ENSMUST00000159294] [ENSMUST00000177755]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034401
AA Change: T159I

PolyPhen 2 Score 0.587 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000034401
Gene: ENSMUSG00000031925
AA Change: T159I

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
low complexity region 144 163 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159294
AA Change: T915I

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000124083
Gene: ENSMUSG00000031925
AA Change: T915I

DomainStartEndE-ValueType
low complexity region 227 245 N/A INTRINSIC
low complexity region 313 331 N/A INTRINSIC
SCOP:d1lsha3 385 459 5e-3 SMART
low complexity region 523 547 N/A INTRINSIC
low complexity region 571 589 N/A INTRINSIC
low complexity region 616 627 N/A INTRINSIC
low complexity region 734 753 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000177755
AA Change: T159I

PolyPhen 2 Score 0.587 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000136866
Gene: ENSMUSG00000031925
AA Change: T159I

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
low complexity region 144 163 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T C 19: 9,015,235 S4628P probably damaging Het
Aspm G A 1: 139,463,182 R735H possibly damaging Het
Atp4a T C 7: 30,715,008 V152A probably benign Het
BC035947 G A 1: 78,498,488 T469I probably damaging Het
Bicra A T 7: 15,988,762 S277T probably benign Het
Catsperg1 A T 7: 29,181,702 N1142K possibly damaging Het
Ccnd3 T C 17: 47,578,720 probably benign Het
Cdc25a A G 9: 109,879,927 K79E probably damaging Het
Cfap44 A G 16: 44,449,028 probably null Het
Chd5 C A 4: 152,382,938 N1644K probably damaging Het
Flrt3 C T 2: 140,660,718 R330H probably damaging Het
Gm6034 T A 17: 36,057,218 probably null Het
Hivep1 A G 13: 42,156,507 E741G probably damaging Het
Iqgap3 T C 3: 88,096,951 V448A probably damaging Het
Itsn2 A G 12: 4,652,382 R679G probably benign Het
Klrb1c A G 6: 128,788,418 S70P possibly damaging Het
Mroh2a G A 1: 88,243,950 R770Q probably damaging Het
Mycl G A 4: 123,000,246 D280N probably damaging Het
Nlrp1b G A 11: 71,228,433 T12I possibly damaging Het
Olfr1315-ps1 T C 2: 112,110,647 N202D probably benign Het
Olfr187 A C 16: 59,036,065 I224S possibly damaging Het
Palmd A G 3: 116,923,463 S462P probably benign Het
Phyhd1 A C 2: 30,269,761 I36L possibly damaging Het
Plcd1 T C 9: 119,074,321 probably null Het
Pml G C 9: 58,219,906 A806G probably damaging Het
Ppp6r1 C A 7: 4,632,396 A838S probably benign Het
Pqlc3 G A 12: 16,999,829 L43F probably damaging Het
Prkdc C T 16: 15,651,538 T169I probably damaging Het
Prr23a1 G T 9: 98,842,935 V117L possibly damaging Het
Pus7 T C 5: 23,768,847 silent Het
Rdh7 T C 10: 127,888,381 E78G probably benign Het
Repin1 G T 6: 48,593,891 probably benign Het
Rptn A G 3: 93,398,123 N921S possibly damaging Het
Sema4f A G 6: 82,918,002 L404P probably damaging Het
Serinc4 T A 2: 121,456,550 M2L probably benign Het
Siglecf T C 7: 43,352,180 V138A probably benign Het
Speer2 T A 16: 69,858,887 Q106L probably damaging Het
Sptb G A 12: 76,603,480 P1821L probably damaging Het
St3gal3 C A 4: 117,958,530 M107I probably benign Het
Tmem25 T C 9: 44,796,008 K265E possibly damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Vsig10 G A 5: 117,338,407 V309I probably benign Het
Zfp318 G GAAGAAA 17: 46,412,542 probably benign Het
Other mutations in Maml2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Maml2 APN 9 13621604 unclassified probably benign
IGL00424:Maml2 APN 9 13620912 missense probably damaging 0.99
IGL02711:Maml2 APN 9 13620063 missense probably benign 0.14
IGL03079:Maml2 APN 9 13621616 unclassified probably benign
IGL03217:Maml2 APN 9 13619999 missense probably damaging 1.00
FR4304:Maml2 UTSW 9 13621459 small deletion probably benign
FR4449:Maml2 UTSW 9 13621456 small deletion probably benign
PIT4810001:Maml2 UTSW 9 13620024 missense
R0102:Maml2 UTSW 9 13705932 synonymous silent
R0318:Maml2 UTSW 9 13620594 missense probably damaging 0.99
R0380:Maml2 UTSW 9 13621100 nonsense probably null
R1433:Maml2 UTSW 9 13706501 missense probably damaging 1.00
R1449:Maml2 UTSW 9 13620684 missense possibly damaging 0.85
R1789:Maml2 UTSW 9 13697345 missense probably damaging 1.00
R2173:Maml2 UTSW 9 13621616 unclassified probably benign
R2363:Maml2 UTSW 9 13621245 missense probably damaging 1.00
R2426:Maml2 UTSW 9 13706498 missense probably damaging 1.00
R2880:Maml2 UTSW 9 13620597 unclassified probably null
R3981:Maml2 UTSW 9 13621068 missense possibly damaging 0.80
R4094:Maml2 UTSW 9 13620153 missense probably benign 0.22
R4117:Maml2 UTSW 9 13705934 missense probably damaging 1.00
R4282:Maml2 UTSW 9 13620110 missense possibly damaging 0.93
R4618:Maml2 UTSW 9 13620075 missense probably damaging 1.00
R4921:Maml2 UTSW 9 13621175 missense probably damaging 1.00
R4957:Maml2 UTSW 9 13620276 missense probably damaging 1.00
R5195:Maml2 UTSW 9 13621114 missense probably damaging 0.98
R5428:Maml2 UTSW 9 13705895 missense probably benign 0.30
R5448:Maml2 UTSW 9 13706467 missense probably damaging 0.98
R5450:Maml2 UTSW 9 13706467 missense probably damaging 0.98
R5455:Maml2 UTSW 9 13705743 nonsense probably null
R5620:Maml2 UTSW 9 13697320 missense probably damaging 1.00
R5973:Maml2 UTSW 9 13621619 unclassified probably benign
R6009:Maml2 UTSW 9 13620998 missense probably benign 0.02
R6054:Maml2 UTSW 9 13621399 small deletion probably benign
R6257:Maml2 UTSW 9 13620426 missense probably damaging 1.00
R6727:Maml2 UTSW 9 13621551 unclassified probably benign
R6824:Maml2 UTSW 9 13697217 missense possibly damaging 0.67
R6998:Maml2 UTSW 9 13621185 unclassified probably benign
R7047:Maml2 UTSW 9 13620881 unclassified probably benign
R7233:Maml2 UTSW 9 13620771 missense
R7326:Maml2 UTSW 9 13621607 missense
R7612:Maml2 UTSW 9 13706485 missense probably benign 0.04
R7652:Maml2 UTSW 9 13621649 missense
R7699:Maml2 UTSW 9 13621089 missense
R7700:Maml2 UTSW 9 13621089 missense
R7803:Maml2 UTSW 9 13621254 small insertion probably benign
R7803:Maml2 UTSW 9 13621275 small insertion probably benign
R7803:Maml2 UTSW 9 13621276 small insertion probably benign
RF015:Maml2 UTSW 9 13621456 small deletion probably benign
RF044:Maml2 UTSW 9 13621456 small deletion probably benign
X0063:Maml2 UTSW 9 13620341 missense probably benign 0.09
Z1177:Maml2 UTSW 9 13706590 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGCTCTGACAAACCCAGTTTC -3'
(R):5'- AGCCCAGTTTGTTGCTGTCG -3'

Sequencing Primer
(F):5'- GTTTCAACACACACCATTTTAACTC -3'
(R):5'- CGTGTTGGCTGTGATCATGACAG -3'
Posted On2018-09-12