Incidental Mutation 'R6854:Pqlc3'
ID535160
Institutional Source Beutler Lab
Gene Symbol Pqlc3
Ensembl Gene ENSMUSG00000045679
Gene NamePQ loop repeat containing
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6854 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location16988648-17000408 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 16999829 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 43 (L43F)
Ref Sequence ENSEMBL: ENSMUSP00000152715 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054536] [ENSMUST00000095823] [ENSMUST00000134938] [ENSMUST00000137960] [ENSMUST00000156360] [ENSMUST00000222203]
Predicted Effect probably damaging
Transcript: ENSMUST00000054536
AA Change: L43F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000054462
Gene: ENSMUSG00000045679
AA Change: L43F

DomainStartEndE-ValueType
CTNS 19 50 4.81e-2 SMART
transmembrane domain 63 85 N/A INTRINSIC
transmembrane domain 92 114 N/A INTRINSIC
transmembrane domain 172 194 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095823
Predicted Effect probably benign
Transcript: ENSMUST00000134938
Predicted Effect probably benign
Transcript: ENSMUST00000137960
Predicted Effect probably damaging
Transcript: ENSMUST00000156360
AA Change: L43F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115895
Gene: ENSMUSG00000045679
AA Change: L43F

DomainStartEndE-ValueType
CTNS 19 50 4.81e-2 SMART
transmembrane domain 65 87 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000222203
AA Change: L43F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T C 19: 9,015,235 S4628P probably damaging Het
Aspm G A 1: 139,463,182 R735H possibly damaging Het
Atp4a T C 7: 30,715,008 V152A probably benign Het
BC035947 G A 1: 78,498,488 T469I probably damaging Het
Bicra A T 7: 15,988,762 S277T probably benign Het
Catsperg1 A T 7: 29,181,702 N1142K possibly damaging Het
Ccnd3 T C 17: 47,578,720 probably benign Het
Cdc25a A G 9: 109,879,927 K79E probably damaging Het
Cfap44 A G 16: 44,449,028 probably null Het
Chd5 C A 4: 152,382,938 N1644K probably damaging Het
Flrt3 C T 2: 140,660,718 R330H probably damaging Het
Gm6034 T A 17: 36,057,218 probably null Het
Hivep1 A G 13: 42,156,507 E741G probably damaging Het
Iqgap3 T C 3: 88,096,951 V448A probably damaging Het
Itsn2 A G 12: 4,652,382 R679G probably benign Het
Klrb1c A G 6: 128,788,418 S70P possibly damaging Het
Maml2 C T 9: 13,705,835 T159I possibly damaging Het
Mroh2a G A 1: 88,243,950 R770Q probably damaging Het
Mycl G A 4: 123,000,246 D280N probably damaging Het
Nlrp1b G A 11: 71,228,433 T12I possibly damaging Het
Olfr1315-ps1 T C 2: 112,110,647 N202D probably benign Het
Olfr187 A C 16: 59,036,065 I224S possibly damaging Het
Palmd A G 3: 116,923,463 S462P probably benign Het
Phyhd1 A C 2: 30,269,761 I36L possibly damaging Het
Plcd1 T C 9: 119,074,321 probably null Het
Pml G C 9: 58,219,906 A806G probably damaging Het
Ppp6r1 C A 7: 4,632,396 A838S probably benign Het
Prkdc C T 16: 15,651,538 T169I probably damaging Het
Prr23a1 G T 9: 98,842,935 V117L possibly damaging Het
Pus7 T C 5: 23,768,847 silent Het
Rdh7 T C 10: 127,888,381 E78G probably benign Het
Repin1 G T 6: 48,593,891 probably benign Het
Rptn A G 3: 93,398,123 N921S possibly damaging Het
Sema4f A G 6: 82,918,002 L404P probably damaging Het
Serinc4 T A 2: 121,456,550 M2L probably benign Het
Siglecf T C 7: 43,352,180 V138A probably benign Het
Speer2 T A 16: 69,858,887 Q106L probably damaging Het
Sptb G A 12: 76,603,480 P1821L probably damaging Het
St3gal3 C A 4: 117,958,530 M107I probably benign Het
Tmem25 T C 9: 44,796,008 K265E possibly damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Vsig10 G A 5: 117,338,407 V309I probably benign Het
Zfp318 G GAAGAAA 17: 46,412,542 probably benign Het
Other mutations in Pqlc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0415:Pqlc3 UTSW 12 16997710 splice site probably benign
R2165:Pqlc3 UTSW 12 16989839 missense probably damaging 0.96
R5405:Pqlc3 UTSW 12 16993314 intron probably benign
R5569:Pqlc3 UTSW 12 16995628 missense possibly damaging 0.93
R6271:Pqlc3 UTSW 12 16997703 missense probably damaging 1.00
R6378:Pqlc3 UTSW 12 16997643 missense probably damaging 1.00
R7831:Pqlc3 UTSW 12 16997631 splice site probably null
R7914:Pqlc3 UTSW 12 16997631 splice site probably null
X0066:Pqlc3 UTSW 12 16995625 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCAGCTCAATTTTCAAACGTC -3'
(R):5'- TTTTGGACTTTGAGCCTCCG -3'

Sequencing Primer
(F):5'- CGCTGAATTTGTAAAATGGGCATGC -3'
(R):5'- GGTTCTCACCTATAAGATCCTGAAC -3'
Posted On2018-09-12